Sh_002I04_g000120

Overview
NameSh_002I04_g000120
Unique NameSh_002I04_g000120
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length2975
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NoteDoubtful hypothetical protein
TypemRNA
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_002I04contigSh_002I04:118353..121327
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_002I04_t000120Sh_002I04_t000120R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_002I04_g000120 ID=Sh_002I04_g000120|Name=Sh_002I04_g000120|organism=R570 Sugarcane cultivar|type=gene|length=2975bp
TGCCCCTGCGACCCCGACGCGGCCGGCGGTGCGGGCGTGACGGCTCCGGC
GACCTCAGAGCGCGCGACGAACGCAGGCACAGCGGGTACGACCACCCCGG
CGCAGGCGTGGGGCTCGAGCTCTCCAGCCCCGGCTCCCCCTCCCAATCCG
GTATGCCGCCGCACACTCGGAGGGCAGTGAGAATCCCTCTGTCGGAGTTC
CAGGCAGCGCCGGATGTGTCCTACAACGAGTAGGAGGCCCTAAAGTACAC
CTCCTCCTCCCGTATCATCGAAATCCAAGTGAGCAAGTGAAGCGCCTCCC
CCATTTGATTTGAGCTTTGCCGATTTTTCGGCGCTGACGCGAAGTCACAT
GCCTTCTTTCAGTCTAGGATTTTCGAGAAGGCGCTACAGCTGCTCGCTCT
TCTCAACGATGGCGTCCCCAAGCTGCTTCTCGACATAGGTCAGCTTACTC
TCTTCTACAGCTCTCCTTCATGAATCATGGCATATCGCGTTGGCTAGAAC
AACATAAAGTATTCTGCTTTGATGGGGGCAAAAATACATGCTGTGAGACC
TCTTAATTACAATCAGTTTTGGCAACCGAAAGATATCTATGTTTATAGAT
ATGTTTACCTACGATGACTTTGTGTGCTGTGATTACCAGGATGTGGTTCT
GGGCTTAGTGGTGAGACATTTGACGCAGCATGTCCACCACTGGATTGGCT
ATGATATTTCAAAGTCGATGCTCGGTGAGGACCTCTCTATGTTCCTTTCT
CTTGGCTTGTTTAGCACCAATTGGAAAGGGAAATGGGAGTTTAGAGGAGG
GGAGCTTTCTAGATATCTTGCTCTGGTGCCTGCATCCTTTTTTAGAACTG
GCAAATCTTCGTGCTTGTAGCGTGGCTATGAAGAACAGGATATCTCCGTG
CTTTCTAGATATCTTAGAACTGATATTCTCCCAGTGAGTTTGGCAAATGA
TCGTATTTCACGATTTTGCTTTCACCTTTTCACAGGAGACACCAGCTTTG
GTAGCCTCTTGATTAATTTGATTAGCTGCAGATAATGATTCATTCCAGTG
AGTATACACTTCCTTATAATTCTCAATGTGTGTTAGGTTTACTTGGATAT
ATTATCACAACCAATTCCCCTATTTCTCAGTGCTAACTATGATTCAAAAT
CTGGCATACTTAGGTGTGGTGTCATTTGTTATGTACAACTTGGAAGAAAT
TGTTTATATGCAAGTTATCCTTATTGCAATTTGAATTAGATCGACTTATA
GCTTGCCCCAGGTACATTCTCCTCCTCTGCTTAGAGAATGGGACTTTTTT
AATGCCATGGTTCTGAGCGGAATTTATATAAAATATATATCTCATAAATC
ATGATATAGATAGATAAATCTCATTATTCCTAAGTTCAATTCAATAGTTT
CTGAAGCCAGTTTCTATAAACAAGTACGAGGATCTATGATTATGGGCATT
CCTGCACAGAGATGTTTCTGTTCAAGAATATTCAGATTTCATATTAGTCA
TATATCTTCTCAAACTTTCAAGATTACAAATACAAAATTTAATCAGCGAC
TTAATCATTTTGCACAACTATTTTTCTACTTTTTGTGACAAATTCAGTTT
GAAATAAAATAACACAAAAGCAAATAGAGAAGTATGGTCTGTTCTTTCCT
CAGACTACAGCTTCATCTATTACCAAATACGTGCACAGTTCCACTACTCA
ATTTTTTTCTATTTAAATGCAGCACATATGTTAATCCATTGTTACCCGAT
CCACTGTCTGTCTTTATCTCGCCCCAAAAGGGGCCTTGTTCCGACACTTC
TACTCCCTCCATGGTTAGTCGGCCGGCTTTGTAGTTATCCGCGTGGAGGC
AGCAAGCTGCAAACCGTAAGGTGTGCGTTGTTTATCTTCACTCTTCTTTG
CATCCTTGACTTGAATTTTAGAAGTTGCTTCTCTTCGATGCTGGCCTCAA
CATCTGCGTTCGAATTAGATTAGCAGAAAATCTAGATACAAGATTTCAAA
TTGAGAGCCATTTTTCTAGATAGAGAATTTCGAATTGAGACTTCTTACCA
ATCTAATATATCCCTGCGTTTGCTATTGTAAGATTGGGTTAAACAAATCT
AAAAATCCTAGATTACCAATGCAGTTTTTTAAGGTTGCTACCTCCTTGCA
GTAGCCGCTTATTGGACACAATTTTAAAAAAGATAGTCATATAAGTTTAC
ATTTGTTGTCTGTATTTCAGCAAACAAGAGTGCTGACACTATTGGTCCTT
CCTTCCAAGTAACCATGATTAATCAGTTATACCACAGATGCAGGTTTGCG
GCCTAACAAATATTCTACTTTGATTTAACGCAAATTATTATCCTCTTCTC
CATGACCCCCTTTTTTTTCCTTATGCATTTGATGCAGTTGTATCATGATA
GCTTTTTCACAAGGTTTCTAGCCACATGAAGTATTCAATAGATTAATAGA
TATATTATTATTTTAGCGATATTGTGTGCCCAATATATCTACCGCCTCAA
TAATAATATAGTATCTTTTAATTTCATAGATAACAATTTTATGCCTTTTC
AACCAGTTGTAGTCGCAGTTCACCTCTTGGATTATTTTCTAATGATGTGC
ACCTCTTTTCAGCTGTCAAATTGATCCATGCTTAGCTGTCCAATTGGTCC
ACCCTGTCTGAACTGATATCTATTTTGCCTGCTCCAAGTGATGCTTAGCA
ATTATCTACTACAGTCCTTATTTAGTTAAGTTTAGGTAAACCAGATATGA
AAGAAGACATGCTAGATGGAGAGTATATTTGTCGCTTGGCTGATAAGTCA
TGGCTGAATGTACTGTTCGCTGATTTATTGTGAGAGGAAAACACTGCTGA
ATGGTTAGCTGATTTGGCTGATAAGCTCAAGCGAACAAGGCGTTAGTTGT
TGATTGATTTGGATATAGTGCCCGTTCTCACTTTCTGCATTACAATGGAT
CAGGAAGAAATAAAGCGAAGTTTCG
back to top

gene from alignment at Sh_002I04:118353..121327-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_002I04_g000120 ID=Sh_002I04_g000120|Name=Sh_002I04_g000120|organism=R570 Sugarcane cultivar|type=gene|length=2975bp|location=Sequence derived from alignment at Sh_002I04:118353..121327- (R570 Sugarcane cultivar)
TGCCCCTGCGACCCCGACGCGGCCGGCGGTGCGGGCGTGACGGCTCCGGC GACCTCAGAGCGCGCGACGAACGCAGGCACAGCGGGTACGACCACCCCGG CGCAGGCGTGGGGCTCGAGCTCTCCAGCCCCGGCTCCCCCTCCCAATCCG GTATGCCGCCGCACACTCGGAGGGCAGTGAGAATCCCTCTGTCGGAGTTC CAGGCAGCGCCGGATGTGTCCTACAACGAGTAGGAGGCCCTAAAGTACAC CTCCTCCTCCCGTATCATCGAAATCCAAGTGAGCAAGTGAAGCGCCTCCC CCATTTGATTTGAGCTTTGCCGATTTTTCGGCGCTGACGCGAAGTCACAT GCCTTCTTTCAGTCTAGGATTTTCGAGAAGGCGCTACAGCTGCTCGCTCT TCTCAACGATGGCGTCCCCAAGCTGCTTCTCGACATAGGTCAGCTTACTC TCTTCTACAGCTCTCCTTCATGAATCATGGCATATCGCGTTGGCTAGAAC AACATAAAGTATTCTGCTTTGATGGGGGCAAAAATACATGCTGTGAGACC TCTTAATTACAATCAGTTTTGGCAACCGAAAGATATCTATGTTTATAGAT ATGTTTACCTACGATGACTTTGTGTGCTGTGATTACCAGGATGTGGTTCT GGGCTTAGTGGTGAGACATTTGACGCAGCATGTCCACCACTGGATTGGCT ATGATATTTCAAAGTCGATGCTCGGTGAGGACCTCTCTATGTTCCTTTCT CTTGGCTTGTTTAGCACCAATTGGAAAGGGAAATGGGAGTTTAGAGGAGG GGAGCTTTCTAGATATCTTGCTCTGGTGCCTGCATCCTTTTTTAGAACTG GCAAATCTTCGTGCTTGTAGCGTGGCTATGAAGAACAGGATATCTCCGTG CTTTCTAGATATCTTAGAACTGATATTCTCCCAGTGAGTTTGGCAAATGA TCGTATTTCACGATTTTGCTTTCACCTTTTCACAGGAGACACCAGCTTTG GTAGCCTCTTGATTAATTTGATTAGCTGCAGATAATGATTCATTCCAGTG AGTATACACTTCCTTATAATTCTCAATGTGTGTTAGGTTTACTTGGATAT ATTATCACAACCAATTCCCCTATTTCTCAGTGCTAACTATGATTCAAAAT CTGGCATACTTAGGTGTGGTGTCATTTGTTATGTACAACTTGGAAGAAAT TGTTTATATGCAAGTTATCCTTATTGCAATTTGAATTAGATCGACTTATA GCTTGCCCCAGGTACATTCTCCTCCTCTGCTTAGAGAATGGGACTTTTTT AATGCCATGGTTCTGAGCGGAATTTATATAAAATATATATCTCATAAATC ATGATATAGATAGATAAATCTCATTATTCCTAAGTTCAATTCAATAGTTT CTGAAGCCAGTTTCTATAAACAAGTACGAGGATCTATGATTATGGGCATT CCTGCACAGAGATGTTTCTGTTCAAGAATATTCAGATTTCATATTAGTCA TATATCTTCTCAAACTTTCAAGATTACAAATACAAAATTTAATCAGCGAC TTAATCATTTTGCACAACTATTTTTCTACTTTTTGTGACAAATTCAGTTT GAAATAAAATAACACAAAAGCAAATAGAGAAGTATGGTCTGTTCTTTCCT CAGACTACAGCTTCATCTATTACCAAATACGTGCACAGTTCCACTACTCA ATTTTTTTCTATTTAAATGCAGCACATATGTTAATCCATTGTTACCCGAT CCACTGTCTGTCTTTATCTCGCCCCAAAAGGGGCCTTGTTCCGACACTTC TACTCCCTCCATGGTTAGTCGGCCGGCTTTGTAGTTATCCGCGTGGAGGC AGCAAGCTGCAAACCGTAAGGTGTGCGTTGTTTATCTTCACTCTTCTTTG CATCCTTGACTTGAATTTTAGAAGTTGCTTCTCTTCGATGCTGGCCTCAA CATCTGCGTTCGAATTAGATTAGCAGAAAATCTAGATACAAGATTTCAAA TTGAGAGCCATTTTTCTAGATAGAGAATTTCGAATTGAGACTTCTTACCA ATCTAATATATCCCTGCGTTTGCTATTGTAAGATTGGGTTAAACAAATCT AAAAATCCTAGATTACCAATGCAGTTTTTTAAGGTTGCTACCTCCTTGCA GTAGCCGCTTATTGGACACAATTTTAAAAAAGATAGTCATATAAGTTTAC ATTTGTTGTCTGTATTTCAGCAAACAAGAGTGCTGACACTATTGGTCCTT CCTTCCAAGTAACCATGATTAATCAGTTATACCACAGATGCAGGTTTGCG GCCTAACAAATATTCTACTTTGATTTAACGCAAATTATTATCCTCTTCTC CATGACCCCCTTTTTTTTCCTTATGCATTTGATGCAGTTGTATCATGATA GCTTTTTCACAAGGTTTCTAGCCACATGAAGTATTCAATAGATTAATAGA TATATTATTATTTTAGCGATATTGTGTGCCCAATATATCTACCGCCTCAA TAATAATATAGTATCTTTTAATTTCATAGATAACAATTTTATGCCTTTTC AACCAGTTGTAGTCGCAGTTCACCTCTTGGATTATTTTCTAATGATGTGC ACCTCTTTTCAGCTGTCAAATTGATCCATGCTTAGCTGTCCAATTGGTCC ACCCTGTCTGAACTGATATCTATTTTGCCTGCTCCAAGTGATGCTTAGCA ATTATCTACTACAGTCCTTATTTAGTTAAGTTTAGGTAAACCAGATATGA AAGAAGACATGCTAGATGGAGAGTATATTTGTCGCTTGGCTGATAAGTCA TGGCTGAATGTACTGTTCGCTGATTTATTGTGAGAGGAAAACACTGCTGA ATGGTTAGCTGATTTGGCTGATAAGCTCAAGCGAACAAGGCGTTAGTTGT TGATTGATTTGGATATAGTGCCCGTTCTCACTTTCTGCATTACAATGGAT CAGGAAGAAATAAAGCGAAGTTTCG
back to top