Sh_002I17_g000010

Overview
NameSh_002I17_g000010
Unique NameSh_002I17_g000010
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length3466
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NoteDExH-box ATP-dependent RNA helicase DExH12
TypemRNA
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_002I17contigSh_002I17:3939..7404
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_002I17_t000010Sh_002I17_t000010R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_002I17_g000010 ID=Sh_002I17_g000010|Name=Sh_002I17_g000010|organism=R570 Sugarcane cultivar|type=gene|length=3466bp
ATGGAATTGGCAAAGCTTTTGGACCGTGTGCCAATTCCTGTGAAAGAGAG
CTTGGAGGAACCCAGTGCAAAGATCAATGTTCTGCTGCAAGCATATATTT
CTAGGTTGAAACTGGAAGGCCTTTCTCTTAGTTCTGATATGGTCTACATC
CGACAGGTAGCGCCATTTTTTTTTTCTGTTGACTGCAATTTATAATTCGC
TTGCATGATTTCACCTACTTAATACAGTTTCTGAATCTGAATTTCTTGCT
TATATTGTACTGTACAGTTATGTTTCCCCCCCTTCTGTAATGCAGAGTGC
TGGACGTCTCCTACGAGCACTATTTGAGATTGTTTTGAAGAGGGGATGGG
CTCAACTAGCGGAGAAAGCGCTGAATCTTTGCAAGATGGTTGATAAACAA
ATGTGGAGTGTCCAGACTCCCCTGCGGCAATTTACTGGAATTCCAAAGGC
GATCTTAATGAAACTGGAGAAAAAGGAGTTGGCTTGGGAGAGGTACTATG
ATCTGTCCTCACAAGAAATTGGTGAACTAATCCGCTATCCCAGGATGGGG
AGGCAGCTGCACAAGTGCATCCACCAGTTACCAAAGTTGAATCTTTCAGC
TCATGTCCAGCCCATCACTCGTACAGTTTTGGGCTTTGAACTGACAATAA
CACCTGATTTCCAGTGGGATGATAAGGTACATGGATATGTGGAGCCCTTT
TGGGTTATTGTTGAGGATAATGATGGCGAGTACATTCTTCACCATGAATA
TTTCATGCTTAAGAAACAGTATGTTGACGAAGATCATACATTGAACTTCA
CAGTGCCGATATATGAGCCACTGCCTCCTCAGTATTTCATACATGTTGTG
TCTGACAAGTGGCTTGGTTCTCAGACAATTCTCCCTGTCTGCTTGAGGCA
CTTGATTCTACCAGAAAAATATGCTCCGCCAACTGAATTGCTTGATCTGC
AGCCTCTACCTGTTAGTGCATTGAGGAATGCAAGATATGAGGGCCTCTAT
AGTGCCTTTAAGCATTTCAATCCCATCCAGACTCAAGTATTCACTGTCTT
GTATAACAGCGATGACAGTGTGCTGGTCGCTGCACCAACGGGCAGTGGGA
AGACGATATGTGCTGAGTTTGCTATACTAAGGAACCACCAGAGGGCAGTG
TCCGGTGAGAGCAACATGCGGGTTGTTTATATAGCTCCCATTGAAGCTCT
CGCAAAAGAAAGGTATGGGGACTGGGAACGGAAATTTGGAGAATTTGCCA
AGGTAGTTGAGCTCACTGGTGAAACCGCAGCTGATTTGAAGCTTCTGGAT
AAAGGAGAGATCATAGTCAGTACTCCTGAAAAGTGGGATGCACTGTCTCG
CCGGTGGAAACAGCGAAAGCACATCCAACAGGTCAGCTTATTCATAGTTG
ATGAACTTCATCTACTTGGGTCTGATAAGGGACATGTTTTGGAAGTCATT
GTATCTAGGATGAGGCGTATTTCAAGTCACATTGGCAGTAACATACGGAT
CGTAGCACTTTCAGCTTCACTTGCTAATGCTAAGGATCTCGGTGAATGGA
TTGGTGCTACCTCTCATGGCCTCTTCAACTTCCCTCCAGCAGTGAGACCT
GTGCCATTGGAAATTTACATTCAGGGTGTGGATATAGCAAACTTCGAGGC
AAGGATGCAAGCAATGACAAAGCCCACCTACACTGCTATCACACAGCATG
CAAAGAACAGTAAACCTGCCCTGGTGTATGTACCGACAAGGAAGCATGCG
AGGTTGACTGCATTGGATTTGTGTGCATACTCTAGTGTTGAGGGTGGTGG
AACTCCGTTTCTCCTTGGGTCAGAAGATGAGATGGATACTTTCACCAGAG
GTGTTGAAGAAGAGACGCTTAAGAATACACTTAAATGTGGTGTAGGCTAT
TTGCATGAGGGTCTAAGTGAACTTGATCAGGAACTTGTAACCCAGCTGTT
CCTTGGTGGGAGGATCCAAGTGTGTGTTGCGAGCAGCACAATGTGTTGGG
GAAGACCATTGCCTGCTCATTTGGTTGTTGTCATGGGGACCCAGTATTAT
GATGGCCGTGAGAATGCTCACACCGATTATCCAATGAGAGATCTGCTTCA
AATGATGGGTCATGCCAGCAGACCACTTCAAGACAACTCGGGGAAATGTG
TTATATTGTGTCACGCACCTCGCAAAGAGTACTACAAGAAGTTCCTTTTT
GAGGCCTTCCCTGTTGAGAGCAATCTTCACCATTTCTTGCATGATCATAT
GAATGCTGAGGTGGTGGTTGGTGTTGTAGAGAATAAGCAAGATGCCGTGG
ATTATCTTACTTGGACTTTCATGTATCGGCGGCTGACAAAGAATCCTAAC
TTCTACAATCTTCAGGATGTAAGTCACAGGCATCTTTCAGATCATCTTTC
TGAGCTAGTTGAGACTGTCCTGAATGATCTCGAATCAAGCAAGTGTGTGG
CTATAGAGGAGGACATGTACCTGAAGCCCCTCAACCTTGGCCTTATTGCT
TCATACTACTATATTGGCTACACAACTATTGAGCGTTTCAGCTCTATGCT
GACCCAGAAGACTAAGATGAAAGGACTCCTAGAGATTCTAGCATCTGCTT
CAGAATATGCAGAGCTTCCGGGTCGTCCGGGTGAGGAAGAATTCATTGAG
AGGCTTGTTCGCCACCAGAGGTTCTCTATCGAGAAGCCCAAGTATGGTGA
TCCACATGTGAAGGCCAATGCTCTGCTGCAAGCCCATTTTTCAAGGCACA
CAGTGGTCGGAAACCTGGCAGCTGATCAGCGTGAGATTCTTCTTTCTGCC
CATAGGTTGCTCCAGGCAATGGTTGATGTTATATCCAGCAATGGTTGGCT
TAGCCTTGCTCTTAGTGCAATGGAGTTGAGTCAAATGGTGACACAAGGCA
TGTGGGATCGGGATTCTGTGCTGCTTCAAGTTCCACACTTCACGAAGGAC
TTGGCCCGGAGGTGCCAGGAAAATGAAGCGAAGCCCATTGAGAGTATCTT
TGATCTTGCTGAGATGGGTGTCGATGAGATGCGGGATCTTTTACAGCTAT
CAAACTCTCAGCTGCAGGACATCATTGAATTCTTCAAGCGGTTCCCTAAT
GTTGATATGACCTACGAGGTCCGTGAGGGTGACGATATAAGCACTGGTGA
CAATGTAACTGTGCAGGTAACGCTGGAGCGCGACATGACTAACTTGCCAT
CTGAGGTTGGTCCAGTCCATGCGCCGAGGTTCCCCAAGCCCAAGGAAGAA
GGCTGGTGGCTGGTGATTGGTGACAGCTCCACAAACCAGTTACTGTCCAT
CAAAAGAGTGGCACTCCAGAAGAGGGCGAGAGTGAAACTTGAGTTCTCTG
CTCCTGCAGAGGCAGGGAGAAAGGATTACATGATTTACTTGATGTCAGAC
TCTTACTTGGGCTGTGATCAGGAGTATGAATTCACTGTTGATGTCAAGGA
TGCTGGAGGGGATTGA
back to top

gene from alignment at Sh_002I17:3939..7404+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_002I17_g000010 ID=Sh_002I17_g000010|Name=Sh_002I17_g000010|organism=R570 Sugarcane cultivar|type=gene|length=3466bp|location=Sequence derived from alignment at Sh_002I17:3939..7404+ (R570 Sugarcane cultivar)
ATGGAATTGGCAAAGCTTTTGGACCGTGTGCCAATTCCTGTGAAAGAGAG CTTGGAGGAACCCAGTGCAAAGATCAATGTTCTGCTGCAAGCATATATTT CTAGGTTGAAACTGGAAGGCCTTTCTCTTAGTTCTGATATGGTCTACATC CGACAGGTAGCGCCATTTTTTTTTTCTGTTGACTGCAATTTATAATTCGC TTGCATGATTTCACCTACTTAATACAGTTTCTGAATCTGAATTTCTTGCT TATATTGTACTGTACAGTTATGTTTCCCCCCCTTCTGTAATGCAGAGTGC TGGACGTCTCCTACGAGCACTATTTGAGATTGTTTTGAAGAGGGGATGGG CTCAACTAGCGGAGAAAGCGCTGAATCTTTGCAAGATGGTTGATAAACAA ATGTGGAGTGTCCAGACTCCCCTGCGGCAATTTACTGGAATTCCAAAGGC GATCTTAATGAAACTGGAGAAAAAGGAGTTGGCTTGGGAGAGGTACTATG ATCTGTCCTCACAAGAAATTGGTGAACTAATCCGCTATCCCAGGATGGGG AGGCAGCTGCACAAGTGCATCCACCAGTTACCAAAGTTGAATCTTTCAGC TCATGTCCAGCCCATCACTCGTACAGTTTTGGGCTTTGAACTGACAATAA CACCTGATTTCCAGTGGGATGATAAGGTACATGGATATGTGGAGCCCTTT TGGGTTATTGTTGAGGATAATGATGGCGAGTACATTCTTCACCATGAATA TTTCATGCTTAAGAAACAGTATGTTGACGAAGATCATACATTGAACTTCA CAGTGCCGATATATGAGCCACTGCCTCCTCAGTATTTCATACATGTTGTG TCTGACAAGTGGCTTGGTTCTCAGACAATTCTCCCTGTCTGCTTGAGGCA CTTGATTCTACCAGAAAAATATGCTCCGCCAACTGAATTGCTTGATCTGC AGCCTCTACCTGTTAGTGCATTGAGGAATGCAAGATATGAGGGCCTCTAT AGTGCCTTTAAGCATTTCAATCCCATCCAGACTCAAGTATTCACTGTCTT GTATAACAGCGATGACAGTGTGCTGGTCGCTGCACCAACGGGCAGTGGGA AGACGATATGTGCTGAGTTTGCTATACTAAGGAACCACCAGAGGGCAGTG TCCGGTGAGAGCAACATGCGGGTTGTTTATATAGCTCCCATTGAAGCTCT CGCAAAAGAAAGGTATGGGGACTGGGAACGGAAATTTGGAGAATTTGCCA AGGTAGTTGAGCTCACTGGTGAAACCGCAGCTGATTTGAAGCTTCTGGAT AAAGGAGAGATCATAGTCAGTACTCCTGAAAAGTGGGATGCACTGTCTCG CCGGTGGAAACAGCGAAAGCACATCCAACAGGTCAGCTTATTCATAGTTG ATGAACTTCATCTACTTGGGTCTGATAAGGGACATGTTTTGGAAGTCATT GTATCTAGGATGAGGCGTATTTCAAGTCACATTGGCAGTAACATACGGAT CGTAGCACTTTCAGCTTCACTTGCTAATGCTAAGGATCTCGGTGAATGGA TTGGTGCTACCTCTCATGGCCTCTTCAACTTCCCTCCAGCAGTGAGACCT GTGCCATTGGAAATTTACATTCAGGGTGTGGATATAGCAAACTTCGAGGC AAGGATGCAAGCAATGACAAAGCCCACCTACACTGCTATCACACAGCATG CAAAGAACAGTAAACCTGCCCTGGTGTATGTACCGACAAGGAAGCATGCG AGGTTGACTGCATTGGATTTGTGTGCATACTCTAGTGTTGAGGGTGGTGG AACTCCGTTTCTCCTTGGGTCAGAAGATGAGATGGATACTTTCACCAGAG GTGTTGAAGAAGAGACGCTTAAGAATACACTTAAATGTGGTGTAGGCTAT TTGCATGAGGGTCTAAGTGAACTTGATCAGGAACTTGTAACCCAGCTGTT CCTTGGTGGGAGGATCCAAGTGTGTGTTGCGAGCAGCACAATGTGTTGGG GAAGACCATTGCCTGCTCATTTGGTTGTTGTCATGGGGACCCAGTATTAT GATGGCCGTGAGAATGCTCACACCGATTATCCAATGAGAGATCTGCTTCA AATGATGGGTCATGCCAGCAGACCACTTCAAGACAACTCGGGGAAATGTG TTATATTGTGTCACGCACCTCGCAAAGAGTACTACAAGAAGTTCCTTTTT GAGGCCTTCCCTGTTGAGAGCAATCTTCACCATTTCTTGCATGATCATAT GAATGCTGAGGTGGTGGTTGGTGTTGTAGAGAATAAGCAAGATGCCGTGG ATTATCTTACTTGGACTTTCATGTATCGGCGGCTGACAAAGAATCCTAAC TTCTACAATCTTCAGGATGTAAGTCACAGGCATCTTTCAGATCATCTTTC TGAGCTAGTTGAGACTGTCCTGAATGATCTCGAATCAAGCAAGTGTGTGG CTATAGAGGAGGACATGTACCTGAAGCCCCTCAACCTTGGCCTTATTGCT TCATACTACTATATTGGCTACACAACTATTGAGCGTTTCAGCTCTATGCT GACCCAGAAGACTAAGATGAAAGGACTCCTAGAGATTCTAGCATCTGCTT CAGAATATGCAGAGCTTCCGGGTCGTCCGGGTGAGGAAGAATTCATTGAG AGGCTTGTTCGCCACCAGAGGTTCTCTATCGAGAAGCCCAAGTATGGTGA TCCACATGTGAAGGCCAATGCTCTGCTGCAAGCCCATTTTTCAAGGCACA CAGTGGTCGGAAACCTGGCAGCTGATCAGCGTGAGATTCTTCTTTCTGCC CATAGGTTGCTCCAGGCAATGGTTGATGTTATATCCAGCAATGGTTGGCT TAGCCTTGCTCTTAGTGCAATGGAGTTGAGTCAAATGGTGACACAAGGCA TGTGGGATCGGGATTCTGTGCTGCTTCAAGTTCCACACTTCACGAAGGAC TTGGCCCGGAGGTGCCAGGAAAATGAAGCGAAGCCCATTGAGAGTATCTT TGATCTTGCTGAGATGGGTGTCGATGAGATGCGGGATCTTTTACAGCTAT CAAACTCTCAGCTGCAGGACATCATTGAATTCTTCAAGCGGTTCCCTAAT GTTGATATGACCTACGAGGTCCGTGAGGGTGACGATATAAGCACTGGTGA CAATGTAACTGTGCAGGTAACGCTGGAGCGCGACATGACTAACTTGCCAT CTGAGGTTGGTCCAGTCCATGCGCCGAGGTTCCCCAAGCCCAAGGAAGAA GGCTGGTGGCTGGTGATTGGTGACAGCTCCACAAACCAGTTACTGTCCAT CAAAAGAGTGGCACTCCAGAAGAGGGCGAGAGTGAAACTTGAGTTCTCTG CTCCTGCAGAGGCAGGGAGAAAGGATTACATGATTTACTTGATGTCAGAC TCTTACTTGGGCTGTGATCAGGAGTATGAATTCACTGTTGATGTCAAGGA TGCTGGAGGGGATTGA
back to top