Sh_002I17_g000020

Overview
NameSh_002I17_g000020
Unique NameSh_002I17_g000020
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length4666
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NoteConserved hypothetical protein
TypemRNA
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_002I17contigSh_002I17:9194..13859
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_002I17_t000020Sh_002I17_t000020R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_002I17_g000020 ID=Sh_002I17_g000020|Name=Sh_002I17_g000020|organism=R570 Sugarcane cultivar|type=gene|length=4666bp
ATGAATGTGCCCACTTATACATCTTTTGCCATATTGGTTTGGTTGCTTTC
TGTTATGTTTGGATTTTTTTTTTGTTCTGTGCCTTTTTCTGTCAATCTTA
GCCAGCTGCTAGGAACTTGCTGACTAGGCACGTCAACTTCTTGATTGCCA
ATTTGCCATACAACACCAAGTTTTGGATAGATTTGAGCCTTTTGACATTT
ATATGCAAAGAAAGAATCAGGTCAATCTAGTACTGATTTTGAGAACATGT
TTATTCATACTGTTATTGTTGATAGTATTATCAATGAACCTAATATTTTA
AGGTTGACAAGGTGCTTCATTGTTTTGATTTCGAGGGGGTGAGGGTGGGT
TATAAGCTTACAAAAGGGTCTAAGTTACTCTACTAAGCATTTGCATTTAT
TTTCTGCTTCAGGACTGCAAAGACCACAAGGAACAAGGTGGGGATTGATT
GCACAAGAGGTGTGAGTAGGGAGCAGAGAGCCATAAACAGAAGGAACAAA
CTTGAGTCATCACTGGTTTCAAGTCGGACTTATGTCCCTAGTGGTAACAA
GAGAGCCTGGAACCGCAACATAAAATGGATGCTAGAACGTGAGTAGTTGA
TTTGAATTTGCTGGTTCTTTCTTTTGTGGTGCATATTGCTCTAGCAAACC
ACTCAGCTGTGGTGTATCATGTTTATTAATCAGGTCGTGCGGCTAATGAG
GCGTATTATAATTTTGAGGAGAATCTATCTGCTATTGCAGTGCAACGATT
CGGTGAACCTTTTCCTGATAGAGAAGATCCAAATGTTGCTTTTGAGGAGA
GGTCATTTGGTGAAATAGTCAAACCTGGTCAATTAACTTATCCAATCAGT
ACTAGTTATGCTGTGGATTTGTCTTCCTTGGTCGTCTCGATTGCTTTGTT
TGATGGTGATTGTGCTACTATACTTTTCAATTTTCCTATAAATTGCATTT
AGTCATCACTTGTTATTTAAATCATGATATTGTCCAGGAGATAAGATGTT
ATTTGCATGCTCGGGCATACCTATACCTCACGGAAGAACTAGACAAAGCC
TAACAAGATTTGTGACATCAGCACATTTGGTTACACAATTCAACAAGAAT
AGAAATAAAGATGATAAGTTGAGGGTTAGTGCTGCTAATCACTGTGTTCC
TTGATTTTTCTTTGTATATTCAAGCTAATTGTGAACATACTGAGCTTGTG
CTTGTGCACTGCTTTTATTTCTGTAGGTTGCAGTGCGCCTTCCTAATAAT
ACAGGTACCGATGGGTTCTTAGGACTATATGATAAAGACATTGCTATCGT
CACATGCTTGGGCTTCCTAGGAGTCCGTCCTATAGATCTGGATCATAAGG
CAAAACCTTTCCCTGGTGATAGTTTGAAAGCTGCTGGGCGTGCCTTCAAC
TCTGGCAGTTTGATGGCCATGCGTGGATCTCTGTATCAGAAACGCCCCCT
CAAACACCTCGAACGCCTCAACACCTGGGTTTCTGATAGTCAAGATATCT
CTAAGGTATACTGTTGATTTATTTATTTGTAACTTTGTGGCATGATGGAA
AACATGGAACACATAACTGCATTATGTTATTGCTGGTCTAAAGTATCATT
GTGTGCATTGAAGTAAATCCTTTCTAAACCTACCACTTTGCTTTTGTTCT
AGGCTGTACTTGGAGGGCCACTTCTGGGGTGGGATAATAAAATTGTCGGG
ATGAGCTTAGATATTTATGACCCTGGTGATGCAAATTTGAGATACACCTT
CCTACCAATGGACTTACTTTGCAAACGTTTGAAGCATTTTCAGATACTCA
AGTATGTCTTCTACACTTACAATATTTATTGACTATTTCTTCAGTTAACC
TGATTCATATTTGTTCCAAACCGTCTCTCCTAATCGACTTCCTGTTTAAG
GTAAGCCATTTTTACTAACAGCATTGGAGACTTAGGAGTTTTCACATGGT
AACCTTTGGATTGAAAATAATTTGGTTCTTCTTACCCCTCTCTACTGAAA
CCAGTACCATTGCCAGATCTTATGATGCTAACTTAGTGCCCATGCTTAAT
GTTTTGGTCTAAATTAGGAAGAATTAAACAATTCTTTGTGGCTATATGGA
CAATGTAACTTATATTTGTGACATGAATATGCTCAATCCTCGCATCTTTT
GTTGAATATTTATGCCTGATTCCAAGTCATTATTTCATACCTTTATTTCT
TTCACAAGACAAGATTAGATTCATGTGTTGGTATGATTGGATTTTTTTTC
CCTGTGTAGTTCCTATGTTTTATTTTGTCATAACGAGTCAACTATGTTTT
ATTGCAGTCCTGAAAAACTACACTTCCGTGGATATACGTTGCCTAAAGAT
GTATCAAGTGTAGTTCCTTCAGGTGTGAACAATACTACAAGCTATCTTCT
AAAATGTTGCCTATGTATCATTGTGCACAGAATACAATGTTACCAGTATC
ACACATATCATCTTGAGGACTAATAATGATCAAAATATTGCATCAGGGTT
TATGCAAACTATTTGCAGGTTAAAGTCCTGTGACTATCCCATTCCACCAC
CGCTTGTGCTCGAATGTAAGTGTTGCTTTTGATATTGCTGTCATCTCCCT
TGTGCCTTTTTGCAGTTCACTTCTGATCTTCGTTCTTTAACTAGTCAATG
GGCAATTGCTTAATCATTTTGAAGAATGCTTTGGTGAATTACTTCCTTGG
AAAGGGTATCCCTTTGGTCATACACCCGGTGGCTCTGGGGAGCGCGTCTG
GAATCAACTTCCAAAAGATGTTGTGACAGATGTATCCCGTCGTGTTGTCT
CACTTGCTTCATTCAATGGTGATTTTTCCAGCTGTGTGCTCCTTACTTTT
TTGTGCTAGTATTTTATCTTCACTAACTAATGATTAAACTTATAATGTGT
AGGGTATGTGAGATCTTTTGCATGCACAGGCTTGCTTATAAAATGGCATG
GAAGCAAAGCTAAGCACACTGTCATCCTGACTTCAGCCAGTTTGGTTAGA
GGTCGTTGTAATGAGGATAGCATTGATAATAGCTTGACGGTTGGTGCTCC
TTAGTCCTTATCCTTACCTTTGGTCTTTTAAGTTTAATGATGGTTTGCTG
AGCTCGCTTTCTCATTGCAGATTGAGGTGTTTCTCCCACCGAATCAACGT
GCTGGTGGGACATTGGAATTTTATAATTTAGACTATAACATTGCTATTGT
CAGTCTCAAGAAGAATTTCAGTGCTATTTGTCCGGACGACATCTTTGCTA
AAAGTGCACAAAACACATCTAAAAAGGTTGTAGCTGTAGGGCGTGATGCT
AAATTTGGTATATTGATGGCCGCAAGTGGTGAAGTGAAGCGTGGAAACAA
GGGTTGCAAACTTGATTGCAAAGATGTTCAGCTGTCTACTTGTAAAATCA
AGAAGGTACTGTGGTGAATCTCTCTTACTGTTCTTTTATATGATAACCAG
TTTAATCATATTGCATGTACTAAACTCATTAGGAATTATTACAAGTTTCC
CAGTAACCTTGGGCCTTTTTTTAAACTAGGCTGGGATTGGAGGCCCGCTT
ATTAATCTTGATGGGAGTTTTGTTGGCATGAACTTCTACGATGGAAGTGG
TGTAACTCCTTTCTTACCAAGGCACAAGATTGTTGAAGTTCTAAGTGGAG
CGGATTCTTTGCCATCAGAATGGTATTATAATTTCATCTCGATGCTAACT
GGTAGGCATGACACTTATTTTACAAACTTTGATTTTTTTTTTGTTTGATG
ACAGTGGATATAACCATCCTGTGCCTGTCAATGTCATTGGTGGGACAAAG
AAGCAGATTCAGAAAAACAGGTATTTCTTTCGGTTTTCGCATTGCCACGT
GTTTCTGTTTGCTTAGACTATTTTATTCCACAGCCAACTTACATAGGGAC
AAAAACACATATTGGATGACAGGTGGCCAGTGCCCGAGCCATATTGGTAT
CATGGCGCACTTGATGCGAGTGTTCTTGATCTAGGCAAGCATATTGGGCG
GCGTCTTAATTAGACATCACATTGCTGGAGTATCTAATTAACCTTGTTCT
GCTTATCAAGCTAGTATCTAACAAACCTTTGGTGCGGTTGCCGTGCTGTT
TATATCTTACTAGTATTTGACAGACCTGTCTAGGATATATGCAAGTTAGA
CTTGTGTTGTAGGGTTATTTATGTGACTTTGCCTCTTGTAACTTACAAGT
TGGTTCAAGGCTCTCATGGACCTTGTTATGCCTCATCTAACAGACCTTTG
GTGCTGTCGCTGTACTGTTTATCATACTTCGACTGTTGTAACTTACAAGT
CGGCTCGAGAGGCGATTACGTCACAAGCACTGTGCCGTTGGTGCTAATCA
GCTAGTTCCTGCTATGGTAATCTCCTGTGCTTTCCTCGTGTTGGTGCTAG
TAATCAGCGAGCCCCTGCTACGGTAAGAAAGTGGGTAGATGCTAGTTCCT
GCTATGGTAATCTCCTGTGCTTTCCTCGTGTTGGTGCTAGTAATCAGCGA
GCCCCTGCTATGGTAAGAAAGTGGGTAGATGCTGGTAGCAGGGTTAGCAA
TTCTTCGTCCAAATGAGTTGCCATGTTTCTTTCTTTTGTTCAGGTTGTAT
ATTGAGGCCATCTCTCATGGATTAATTTCGTGGATTTTGTTTATGGTTGT
TGGGAACTGATAAGCT
back to top

gene from alignment at Sh_002I17:9194..13859-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_002I17_g000020 ID=Sh_002I17_g000020|Name=Sh_002I17_g000020|organism=R570 Sugarcane cultivar|type=gene|length=4666bp|location=Sequence derived from alignment at Sh_002I17:9194..13859- (R570 Sugarcane cultivar)
ATGAATGTGCCCACTTATACATCTTTTGCCATATTGGTTTGGTTGCTTTC TGTTATGTTTGGATTTTTTTTTTGTTCTGTGCCTTTTTCTGTCAATCTTA GCCAGCTGCTAGGAACTTGCTGACTAGGCACGTCAACTTCTTGATTGCCA ATTTGCCATACAACACCAAGTTTTGGATAGATTTGAGCCTTTTGACATTT ATATGCAAAGAAAGAATCAGGTCAATCTAGTACTGATTTTGAGAACATGT TTATTCATACTGTTATTGTTGATAGTATTATCAATGAACCTAATATTTTA AGGTTGACAAGGTGCTTCATTGTTTTGATTTCGAGGGGGTGAGGGTGGGT TATAAGCTTACAAAAGGGTCTAAGTTACTCTACTAAGCATTTGCATTTAT TTTCTGCTTCAGGACTGCAAAGACCACAAGGAACAAGGTGGGGATTGATT GCACAAGAGGTGTGAGTAGGGAGCAGAGAGCCATAAACAGAAGGAACAAA CTTGAGTCATCACTGGTTTCAAGTCGGACTTATGTCCCTAGTGGTAACAA GAGAGCCTGGAACCGCAACATAAAATGGATGCTAGAACGTGAGTAGTTGA TTTGAATTTGCTGGTTCTTTCTTTTGTGGTGCATATTGCTCTAGCAAACC ACTCAGCTGTGGTGTATCATGTTTATTAATCAGGTCGTGCGGCTAATGAG GCGTATTATAATTTTGAGGAGAATCTATCTGCTATTGCAGTGCAACGATT CGGTGAACCTTTTCCTGATAGAGAAGATCCAAATGTTGCTTTTGAGGAGA GGTCATTTGGTGAAATAGTCAAACCTGGTCAATTAACTTATCCAATCAGT ACTAGTTATGCTGTGGATTTGTCTTCCTTGGTCGTCTCGATTGCTTTGTT TGATGGTGATTGTGCTACTATACTTTTCAATTTTCCTATAAATTGCATTT AGTCATCACTTGTTATTTAAATCATGATATTGTCCAGGAGATAAGATGTT ATTTGCATGCTCGGGCATACCTATACCTCACGGAAGAACTAGACAAAGCC TAACAAGATTTGTGACATCAGCACATTTGGTTACACAATTCAACAAGAAT AGAAATAAAGATGATAAGTTGAGGGTTAGTGCTGCTAATCACTGTGTTCC TTGATTTTTCTTTGTATATTCAAGCTAATTGTGAACATACTGAGCTTGTG CTTGTGCACTGCTTTTATTTCTGTAGGTTGCAGTGCGCCTTCCTAATAAT ACAGGTACCGATGGGTTCTTAGGACTATATGATAAAGACATTGCTATCGT CACATGCTTGGGCTTCCTAGGAGTCCGTCCTATAGATCTGGATCATAAGG CAAAACCTTTCCCTGGTGATAGTTTGAAAGCTGCTGGGCGTGCCTTCAAC TCTGGCAGTTTGATGGCCATGCGTGGATCTCTGTATCAGAAACGCCCCCT CAAACACCTCGAACGCCTCAACACCTGGGTTTCTGATAGTCAAGATATCT CTAAGGTATACTGTTGATTTATTTATTTGTAACTTTGTGGCATGATGGAA AACATGGAACACATAACTGCATTATGTTATTGCTGGTCTAAAGTATCATT GTGTGCATTGAAGTAAATCCTTTCTAAACCTACCACTTTGCTTTTGTTCT AGGCTGTACTTGGAGGGCCACTTCTGGGGTGGGATAATAAAATTGTCGGG ATGAGCTTAGATATTTATGACCCTGGTGATGCAAATTTGAGATACACCTT CCTACCAATGGACTTACTTTGCAAACGTTTGAAGCATTTTCAGATACTCA AGTATGTCTTCTACACTTACAATATTTATTGACTATTTCTTCAGTTAACC TGATTCATATTTGTTCCAAACCGTCTCTCCTAATCGACTTCCTGTTTAAG GTAAGCCATTTTTACTAACAGCATTGGAGACTTAGGAGTTTTCACATGGT AACCTTTGGATTGAAAATAATTTGGTTCTTCTTACCCCTCTCTACTGAAA CCAGTACCATTGCCAGATCTTATGATGCTAACTTAGTGCCCATGCTTAAT GTTTTGGTCTAAATTAGGAAGAATTAAACAATTCTTTGTGGCTATATGGA CAATGTAACTTATATTTGTGACATGAATATGCTCAATCCTCGCATCTTTT GTTGAATATTTATGCCTGATTCCAAGTCATTATTTCATACCTTTATTTCT TTCACAAGACAAGATTAGATTCATGTGTTGGTATGATTGGATTTTTTTTC CCTGTGTAGTTCCTATGTTTTATTTTGTCATAACGAGTCAACTATGTTTT ATTGCAGTCCTGAAAAACTACACTTCCGTGGATATACGTTGCCTAAAGAT GTATCAAGTGTAGTTCCTTCAGGTGTGAACAATACTACAAGCTATCTTCT AAAATGTTGCCTATGTATCATTGTGCACAGAATACAATGTTACCAGTATC ACACATATCATCTTGAGGACTAATAATGATCAAAATATTGCATCAGGGTT TATGCAAACTATTTGCAGGTTAAAGTCCTGTGACTATCCCATTCCACCAC CGCTTGTGCTCGAATGTAAGTGTTGCTTTTGATATTGCTGTCATCTCCCT TGTGCCTTTTTGCAGTTCACTTCTGATCTTCGTTCTTTAACTAGTCAATG GGCAATTGCTTAATCATTTTGAAGAATGCTTTGGTGAATTACTTCCTTGG AAAGGGTATCCCTTTGGTCATACACCCGGTGGCTCTGGGGAGCGCGTCTG GAATCAACTTCCAAAAGATGTTGTGACAGATGTATCCCGTCGTGTTGTCT CACTTGCTTCATTCAATGGTGATTTTTCCAGCTGTGTGCTCCTTACTTTT TTGTGCTAGTATTTTATCTTCACTAACTAATGATTAAACTTATAATGTGT AGGGTATGTGAGATCTTTTGCATGCACAGGCTTGCTTATAAAATGGCATG GAAGCAAAGCTAAGCACACTGTCATCCTGACTTCAGCCAGTTTGGTTAGA GGTCGTTGTAATGAGGATAGCATTGATAATAGCTTGACGGTTGGTGCTCC TTAGTCCTTATCCTTACCTTTGGTCTTTTAAGTTTAATGATGGTTTGCTG AGCTCGCTTTCTCATTGCAGATTGAGGTGTTTCTCCCACCGAATCAACGT GCTGGTGGGACATTGGAATTTTATAATTTAGACTATAACATTGCTATTGT CAGTCTCAAGAAGAATTTCAGTGCTATTTGTCCGGACGACATCTTTGCTA AAAGTGCACAAAACACATCTAAAAAGGTTGTAGCTGTAGGGCGTGATGCT AAATTTGGTATATTGATGGCCGCAAGTGGTGAAGTGAAGCGTGGAAACAA GGGTTGCAAACTTGATTGCAAAGATGTTCAGCTGTCTACTTGTAAAATCA AGAAGGTACTGTGGTGAATCTCTCTTACTGTTCTTTTATATGATAACCAG TTTAATCATATTGCATGTACTAAACTCATTAGGAATTATTACAAGTTTCC CAGTAACCTTGGGCCTTTTTTTAAACTAGGCTGGGATTGGAGGCCCGCTT ATTAATCTTGATGGGAGTTTTGTTGGCATGAACTTCTACGATGGAAGTGG TGTAACTCCTTTCTTACCAAGGCACAAGATTGTTGAAGTTCTAAGTGGAG CGGATTCTTTGCCATCAGAATGGTATTATAATTTCATCTCGATGCTAACT GGTAGGCATGACACTTATTTTACAAACTTTGATTTTTTTTTTGTTTGATG ACAGTGGATATAACCATCCTGTGCCTGTCAATGTCATTGGTGGGACAAAG AAGCAGATTCAGAAAAACAGGTATTTCTTTCGGTTTTCGCATTGCCACGT GTTTCTGTTTGCTTAGACTATTTTATTCCACAGCCAACTTACATAGGGAC AAAAACACATATTGGATGACAGGTGGCCAGTGCCCGAGCCATATTGGTAT CATGGCGCACTTGATGCGAGTGTTCTTGATCTAGGCAAGCATATTGGGCG GCGTCTTAATTAGACATCACATTGCTGGAGTATCTAATTAACCTTGTTCT GCTTATCAAGCTAGTATCTAACAAACCTTTGGTGCGGTTGCCGTGCTGTT TATATCTTACTAGTATTTGACAGACCTGTCTAGGATATATGCAAGTTAGA CTTGTGTTGTAGGGTTATTTATGTGACTTTGCCTCTTGTAACTTACAAGT TGGTTCAAGGCTCTCATGGACCTTGTTATGCCTCATCTAACAGACCTTTG GTGCTGTCGCTGTACTGTTTATCATACTTCGACTGTTGTAACTTACAAGT CGGCTCGAGAGGCGATTACGTCACAAGCACTGTGCCGTTGGTGCTAATCA GCTAGTTCCTGCTATGGTAATCTCCTGTGCTTTCCTCGTGTTGGTGCTAG TAATCAGCGAGCCCCTGCTACGGTAAGAAAGTGGGTAGATGCTAGTTCCT GCTATGGTAATCTCCTGTGCTTTCCTCGTGTTGGTGCTAGTAATCAGCGA GCCCCTGCTATGGTAAGAAAGTGGGTAGATGCTGGTAGCAGGGTTAGCAA TTCTTCGTCCAAATGAGTTGCCATGTTTCTTTCTTTTGTTCAGGTTGTAT ATTGAGGCCATCTCTCATGGATTAATTTCGTGGATTTTGTTTATGGTTGT TGGGAACTGATAAGCT
back to top