Sh_002L05_g000040

Overview
NameSh_002L05_g000040
Unique NameSh_002L05_g000040
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length1402
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NoteConserved hypothetical protein
TypemRNA
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_002L05contigSh_002L05:41489..42890
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_002L05_t000040Sh_002L05_t000040R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_002L05_g000040 ID=Sh_002L05_g000040|Name=Sh_002L05_g000040|organism=R570 Sugarcane cultivar|type=gene|length=1402bp
ATGCTGCCGGCAAGGGCCCTGACGCTGGAGACGTACCACCGTTTCTTCCT
CGACCCATGGAACACCCGCATCACCGTCGACCAACTCAACCAGGTACTGT
ATGCACTAGTAGATTAGCAACTATCAGATCTCTCTTTTCTTTCACACCGC
ACACACACACACATCCAGTTCTTCCTCCTATTTCTCTTCAATCTTCAGTG
TTTCTGCAATGCATGTTGATTTTCAACGTCGTGCCATTTCCTCTTCCCTG
AAACTTTGATCAGTCCTCCATCTCCTATGTCCCTATGTAATGTAACGCGT
GGTGAGGGTTTCCTCTTCCTGCAGATCCTCTTCATGCATGGCTTCGCCAA
GCTCCACCATGGCCAAAAGGTAAATCTGGCATCGCGAACTAACCAAACCT
CCATTAAACCCCGTTTCCTCGTTGTTACGTTTCCCCCTCCACTGCTGTGT
TCCTAACGCACATGGAGCTGTTCTTGCGAGGGGACGCTGCGGCCAGGCCA
AGATCATGGAGCGCCTGGTGGGGCAAGTGGACCTGCTGCCGCCGCGCCGC
TCCACGCTGCACCGCGCGGCGCTGTCCGTCGCGACGCCGCCTTCCGCGGC
CGTCATCACCGCGGCGCAGGCTAGGGACGACGTCGAGGCGATCGGGTGGG
CCGAGTGCCCCATCGGCTGCGTCGCCGCGTTCGCCGCGCCGAGTGCGGAC
GCGCCGGAGCCGGTGGAGCGCGTGCCTTGGCCCGCCGACTTCGTCCTCAC
CGGGCGCCGCCCGCGGTCCAAGCGGACGCGCGGCTCTGCGTATGGGCCAA
GGGACGTCGCCGCCGCGTCCATGAAGTCGAAGGCGGGCGCAGGCGCGCCA
CGGAAACAGGTGAAGGTTGTCGTCAAGGAGGAGGAGAGGGAGCCGGAGCT
GGTGCCACCGCCTCCTCCGCCACCGCTCTGGACGCGGTCTCCGACTCCAC
CTCCGCCTGCTTCGCCGCCTCCGCCACAGGATGTGGTGCCACCGCCGCCG
CCGCCGCCTCCACCGTGCCAGCCTCAACCTACGTTGGCGCCGATCCCCTT
GCCTCCAGGCTGGGGCACGCCGATGGGCCTGCCGCATCCTTCGCAGCAGC
TGTTCTTGGGGTCGCCTCTGCCCACACGGCCAACCGCTCAGCCGTGCCCT
GCAACGCCACCACCGGGATGGAGCGTACCTACGCCGCCGCCGTCTTTCCC
AGCACCGTTCTGGGGCGCGCCCGTAATGCTGCCGCCATTGCCACCGCATG
TGGCCTGGCGCTGGCCGCCCGGCACGGCGCCGCACTGGGGCAGCATGTTG
TCGCCAGAGCACCCGCCCATGCACCTGCAGCGATCACCACCTCCCCTGCT
GCTGCAACACAGCCACCACCGCATTTTCAGGGTCAGCCGCTGCCTGCGCT
GA
back to top

gene from alignment at Sh_002L05:41489..42890-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_002L05_g000040 ID=Sh_002L05_g000040|Name=Sh_002L05_g000040|organism=R570 Sugarcane cultivar|type=gene|length=1402bp|location=Sequence derived from alignment at Sh_002L05:41489..42890- (R570 Sugarcane cultivar)
ATGCTGCCGGCAAGGGCCCTGACGCTGGAGACGTACCACCGTTTCTTCCT CGACCCATGGAACACCCGCATCACCGTCGACCAACTCAACCAGGTACTGT ATGCACTAGTAGATTAGCAACTATCAGATCTCTCTTTTCTTTCACACCGC ACACACACACACATCCAGTTCTTCCTCCTATTTCTCTTCAATCTTCAGTG TTTCTGCAATGCATGTTGATTTTCAACGTCGTGCCATTTCCTCTTCCCTG AAACTTTGATCAGTCCTCCATCTCCTATGTCCCTATGTAATGTAACGCGT GGTGAGGGTTTCCTCTTCCTGCAGATCCTCTTCATGCATGGCTTCGCCAA GCTCCACCATGGCCAAAAGGTAAATCTGGCATCGCGAACTAACCAAACCT CCATTAAACCCCGTTTCCTCGTTGTTACGTTTCCCCCTCCACTGCTGTGT TCCTAACGCACATGGAGCTGTTCTTGCGAGGGGACGCTGCGGCCAGGCCA AGATCATGGAGCGCCTGGTGGGGCAAGTGGACCTGCTGCCGCCGCGCCGC TCCACGCTGCACCGCGCGGCGCTGTCCGTCGCGACGCCGCCTTCCGCGGC CGTCATCACCGCGGCGCAGGCTAGGGACGACGTCGAGGCGATCGGGTGGG CCGAGTGCCCCATCGGCTGCGTCGCCGCGTTCGCCGCGCCGAGTGCGGAC GCGCCGGAGCCGGTGGAGCGCGTGCCTTGGCCCGCCGACTTCGTCCTCAC CGGGCGCCGCCCGCGGTCCAAGCGGACGCGCGGCTCTGCGTATGGGCCAA GGGACGTCGCCGCCGCGTCCATGAAGTCGAAGGCGGGCGCAGGCGCGCCA CGGAAACAGGTGAAGGTTGTCGTCAAGGAGGAGGAGAGGGAGCCGGAGCT GGTGCCACCGCCTCCTCCGCCACCGCTCTGGACGCGGTCTCCGACTCCAC CTCCGCCTGCTTCGCCGCCTCCGCCACAGGATGTGGTGCCACCGCCGCCG CCGCCGCCTCCACCGTGCCAGCCTCAACCTACGTTGGCGCCGATCCCCTT GCCTCCAGGCTGGGGCACGCCGATGGGCCTGCCGCATCCTTCGCAGCAGC TGTTCTTGGGGTCGCCTCTGCCCACACGGCCAACCGCTCAGCCGTGCCCT GCAACGCCACCACCGGGATGGAGCGTACCTACGCCGCCGCCGTCTTTCCC AGCACCGTTCTGGGGCGCGCCCGTAATGCTGCCGCCATTGCCACCGCATG TGGCCTGGCGCTGGCCGCCCGGCACGGCGCCGCACTGGGGCAGCATGTTG TCGCCAGAGCACCCGCCCATGCACCTGCAGCGATCACCACCTCCCCTGCT GCTGCAACACAGCCACCACCGCATTTTCAGGGTCAGCCGCTGCCTGCGCT GA
back to top