Sh_001B06_g000050

Overview
NameSh_001B06_g000050
Unique NameSh_001B06_g000050
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length5507
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_001B06contigSh_001B06:26869..32375
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
TypemRNA
NotePentatricopeptide repeat-containing protein At1g76280
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_001B06_t000050Sh_001B06_t000050R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_001B06_g000050 ID=Sh_001B06_g000050|Name=Sh_001B06_g000050|organism=R570 Sugarcane cultivar|type=gene|length=5507bp
ATGCAAAAAATTGGATTGCAACCATCAAATTTTACATATGACGGCTTTGT
TAAGACTGTGATAGCTGGGAAAGGAATTGCATATGCCAACAAAGTGGTAT
GCTACCAGCAGCTTTGCTCATATGATCCTGTAGCCTGAAAGGACATCTCT
CTAAATTGATGATGACATACACCATTTTTTTTTTAATTTTTAATTAAACC
AATTAGTTGTATTGCTCTGATTTCCATTAGGCCATGTTTGGTTGGAGGGG
ATTGAATCCCCAAGTGGAACCAATCCAGAGAGGGATTGAGTGGATCCCTC
CCTTGTCACTCAAACCCCTTGAGGATTAAATCCCTTCTTTCCCATTCTCA
CTCTCCGTCCAAATGGTGTTCGGTTAATCCCTCTCTTCTTTCCCTGTTCA
GTTGTGTTAGGTCGTCAAGCACAGTTCCAGCTTTTTTACATGGCTAGACA
ATGAACTGAACATGACGAGAACATGGATCTATGGATCTAGACAATAAGCT
CATAAATAAAATATTACAAGTCTCAAAAGACTAGTACGTCTCAAAAGAAC
TGAACATGACGAGAGACATGGATCCTCGTCATGGATCTAGACAATGATGC
ATTTTGCTATTTGGCAGAACAGCAGTGTACAGAAAACACCCTTCACCTTG
TCAACCTCCTCTGGCAACTAGTCCGGTACATGCCTACCAACAAAAAGAAT
TAGGGTCCCAAAGAATTATTAGTTTCTGACACAAATTGTCACATATGGGG
ATGAAAAAAATAATTGCAATCGTATAATATACTCCCTCCGTTCCAAATTA
TAAGTCGCTTTGACTCTTTTGGTACATCCATTTTACTATGTATCTAGACA
TAACGTATTTCTAGATACATAGAAAAATGGATGTACCAAAAAAGTCAAAG
CGACTTATAATTTGGAACGGAGGGAGGAGTAATTAAACAATATGAAATTG
AAGTATGAGACATGTTTGCCTCAATGCAACCAAACACTAAAAAAATACAG
TTACACTGACACAAAATTGCATTATGGCAATTGTCCTCTTTTCAGAGGTT
AAGGCAAACAAATCGAAACATCATTTATACTATATAATATCATAAAACTA
ATGGGGATAAGTAACACCATTCAGTGGCACTATAGTTAAACAAATAATAA
GATAACTCGACACTATATAGAGAGCAATCACAATCGGCATTCGGAAATCA
CACACAAACAGCTTCAGAAGCATGCAAGAACTAGTAGTACTCAAATCAGT
GTCTGGCTGTCTGCAAGATATGCTTTATGTAACAACAAAAAGTAGAAGAA
TGAAGAGTAGACAGATAGGCCTGAAAGAACTTTACTCCCACTTCATAATA
TATACCATTGCATAATCAATCTCCAAGGGTATGTTGACTTGCCAACATTA
AAATTCATGAGTAAACTTACTATCAGTTAATTTAGAACTCCATGCAACTT
CTTTTTAATAAAATGCCAAGAAAAAATATGTTTAAAGTTGAGTAATAGTA
GAATAAACATGAACTGGTCAGACATGCATACTAACGATTATTTTGTAGAT
TCAGCAATCTAGATTGGTCATGGTTGGTTTGCACTAGTTTGCTTGAGACT
TGGGGAGATGTCTGGTAACTCAAACATAGTAATAGTCTAACAGAGATCGC
TAGAAGCAAAAAGGAGAAAAGCCATTGAAATCGAAACATTATGGTTAATC
GTGATAGCTTGATGCATAGGCTGCATGCTGATGCATTAACATTCAATGAT
GAACTGATGCATAAACTGAATATTCAGTATGCTGCAAGCTCTCATACAAA
CAATGCCTATGCCTACTGTTCTAGCTAGTGTAATTATGAGATTCATACTG
AAAATTCACAAGTAGAAGCGCTCGTAATAGTCAGGGATGAAAATAGAATT
CACAAAATTGAGTCTTCCTTGCCGGTGTAAGAAAATAATGAATAAACCAA
TTAATCTCTCGTGGATAAAAATAATCGAGCTGGATCAAACAAGCGTCATA
GAACCGGCCGCTGAACTAGGTAGAACGGAGACAGACAGAACATTGCCTCA
CTGGTCACCGCGGAGGTCACACGGTGTGCTTGTCAACTCAAGAACCCTAC
AGCATGGAAGAGGTGAGGGGAAACTTACAGGCGAGAAGGTGGCTACCTGA
GGGGACGGCCACCGCCGTGAAGATCGCCGCGTTGCCGTTGTCGAAGCCTC
CAAATCTTGCCGCCACCGAGATGCCGTTGTACCTCGCCTTCGTGGCGATG
CTTCCCCTCGGCGCTCGTAGCCGACGCGTCCCGTGAAGCGCTCCAGCCGT
CGCGAGCCCTCCGCAACGATGCGAGGACCTAGTGACCTGGCAGCAGGTTG
TGCGTTCGCCTCCGTGGGGAATTGTTCCGTGACTCATGCGGAGTGGGTGG
AAACCAGGCTGGGGTGGAGGGTAATCGCCTGGAATAGGACGGGGTAGAAT
CTTCGGGTCGGCTAACCAAACGCCACTTTCACGGTGAGCCGGGCTTGAAT
CCGCTTCGGGAGCATCCCTGTGGATCGGGCCGCGAACCCCGTGGGGAATG
GCCTAACTGAACAAGGCCTTAAAGTAGATTGAGACTCTGTCCGATTATTA
TTAAGAATACTGCAATGTTAAGAATATTTTTACCTACTCTCCTAAAGCCA
CTATGCAAAATTGAGCTATACCTGTAATATTGCTATTAAATCCTCGAACT
ATGGTCCATTTTACTTGCTTAAGACATCGTTAGTCTTGAGTGTGCATGCC
TGGCTATTGCATTTTCTATATGTCAACAAAACAATAAAACTATAATCTAG
CAGCACTTTGATATTACATTATTACTTTTTACACGACAAATTTAAGTACT
TTTACATGTATTGGAAATTTGAAAGGTTTGACTTCACAGTCCACATATCC
GGACAATATCAATTTTATTTGGAGATAAATTATTTTCTCACGTATATCTT
ATATTCATATGTTTTCCAGATTAAAGCCATGGAGAGAAGGGGCATTGGAC
TTTACAGTGATACACTTGCTGCTCTCTCAGTAGGGCATAGCAATAGTTCA
CAGTTGGATTTGGCTGAGGAACTTTTGGAAAGAATTTCAGAGATAAAACC
AAAGCATCTACGTGCCTTTAATGCTTTGCTTTCTGGATGTGCGATTATGG
TAATGCATTGAATCTGGAAATAGATTTTATGATATTGGGTTTGTGTCCCT
TGCGCTGAATCTGCAAATGCTTGATGCTCTACATAACGTCCACATCCACA
GAAAGTAGTTTCCTATAGCTGTCACTGCACCAACCTGCCAAATTAAAGTT
TCTGTTTCATTAATAAGAAGAATGAACTAAACCTCTCCTCCCCTTCCCCC
CTTTTCTTGGCAGAATGAACCAGAAAGAGCTGTGCGCATACTAGCTAAAA
TGAAACATGTGAACATGAAGCCAACTCTCAGGACATATGAACTTTTGTTT
TCTCTGTTTGGAAATGTAAATGTTCCTTATGAAGAAGGAAATGTGCTCTC
TCATGTTGATGTTTCCAAAAGGATAAGTATCATTGAGATGGACATGTTTA
ACAATGGAATCCAACACAGCTTTGTGTCTATGAAGAACTTGGTAAGTCTT
CTTTCTATGTACTGTAGAGATCTAAGATATTTGGCAATAGTATGTATCCA
GTTAGGAACCAATTCCATTTGTTGGCCTTTTCACATTGTCCACATCATGC
TTTAACTTGTCCGAATAGGAAAATAGCTGATTTATACTTGTCTTAATCTT
CTCTGTTTCTATCTAAAATTCCCTGTGAACTGTGACAGTTATTACTTAAA
GGTAATAAGTCCACTACTATTTCCAGTGGTCAATTTAGTATATTTTTATG
GTAATCGGAAGCACCACCTGAAGAGGACATATCATTGTTGTTTTGTGAAA
AGTCTGAATATTTTCTCGCCAGCTAGTTCCCACTGGATGTCATAACCCAA
AATCTTGCCAGTTAGTTCTCACAGACAGTTTACTGATTGAATTATCATCA
TGCCATCTATAAAAATTTCTGGTATTGTGGTTTAACTTGCCAGTCACATC
CCTCAGTGCTTCTTATGCTGAAAAATCCTTTTAATGTTCTATTTATTCTG
TTTCAGATACGAGCTTTTGGATCTGAGGGGATGATAGAGGAAATGCTGAG
GTACCTGAATATAGCAGAAAATATTTTGTGGAACATAAATCCTTATCAGA
AGAGTGATCTATACAGCATTGCGTTGCATGCTCTGGTTGATGCGAAGGAA
GTACGTATCAACAACCTTTTAAGTTTGTTCCGATGTGACAAAATGAGGAT
TATTTTATCTCTTCTCTTTGTAAGGCATGTAAATCTAGTTGTAACAGCTA
TTTTAGCTCATTTAATCTCGCTGAATTTGATGGGGAGATCCCAAGTGCAG
TCACCAGTTATGTTGTAGTTATGGTGTTATGCAACCACCAAAGAAATTTT
AGTTACAGTGTTAAGCAATCACCGCTAAATTGGGCGTGGAATCAATAATA
AAAAAATTTCTAAATAATTAAAGATTCATTCACTTTACTTGCTTACTTGC
AAAATTCATGTTCAGATTGTTTCTGTGTTACGGATTATATAGCATACAGT
TCTTTTCTTTTGTTCTATCTAAAGCTATAGTACATTTGGAGTTTTTAGTT
GAAATTTGAAAGTACTCCCTCCGTTCCAAATTGTAAGTCGTTCTTGTCCT
AAGTTAAACTTCTCTAGCTTTGACTAAGTTTATAGAAAAATGCATAAACA
TCTGCAACATCAAACTAGATTCATTAGATACACCATGGTAGTTTGATATC
GCAGATGTTAATGTACTTTTCTATAAACTTAGTCAAAGTTAGACAAGTTT
GACTTAGGGCAAAGCTGAAACAACTTACAATTTGCAGTGGAGGAATTATG
CTACAACACTCCATAGACTGTATATTGTCAAAGTTTTCGAATGGGAACTG
GTTCATGTTGGTTTGGTACTTTGGTGCCAAACTGAAATTTCATTGCATGA
CTGCATTTTGCAGATATTGAACTTGTGTTATAAATCTTGATCCATGTTTC
TTTTCTGGTATGCAGACTCACAGAGCAGTAATGGTCTTCAAAATCATGAG
ATCATGCAGCCTTCCAACTAATATTTCAATTTATAATACCATGATAGAGT
GCTGCAAATGGCTGCAATGTTTCAAATCAGCTAGTGCTTTGCTGTCTTTG
ATGCTCCAAGATGGCTTCAATCCTACGGTTGTGACTCTTACATCACTCCT
GAAGGTAAGTCTGGCTAAGAATAATACATATGTCTTTTAGATCTATCATA
TTACCGATTACATATTAGTTGGGTTGACTTTTAGTGGTCCGATTGATCTC
ATGTCTTTTTCATGATGTAAGATAGGTTGTATTAGCAAATAATAATTTTG
AAGGGGCTCTGGATCTGCTTGATATATGCAAGATTGAAGGACTTCAGCCT
GACATACATATTTTCAACACAGTACTCTCACGTGCATATGCTAGAGTATG
TTTATGA
back to top

gene from alignment at Sh_001B06:26869..32375-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_001B06_g000050 ID=Sh_001B06_g000050|Name=Sh_001B06_g000050|organism=R570 Sugarcane cultivar|type=gene|length=5507bp|location=Sequence derived from alignment at Sh_001B06:26869..32375- (R570 Sugarcane cultivar)
ATGCAAAAAATTGGATTGCAACCATCAAATTTTACATATGACGGCTTTGT TAAGACTGTGATAGCTGGGAAAGGAATTGCATATGCCAACAAAGTGGTAT GCTACCAGCAGCTTTGCTCATATGATCCTGTAGCCTGAAAGGACATCTCT CTAAATTGATGATGACATACACCATTTTTTTTTTAATTTTTAATTAAACC AATTAGTTGTATTGCTCTGATTTCCATTAGGCCATGTTTGGTTGGAGGGG ATTGAATCCCCAAGTGGAACCAATCCAGAGAGGGATTGAGTGGATCCCTC CCTTGTCACTCAAACCCCTTGAGGATTAAATCCCTTCTTTCCCATTCTCA CTCTCCGTCCAAATGGTGTTCGGTTAATCCCTCTCTTCTTTCCCTGTTCA GTTGTGTTAGGTCGTCAAGCACAGTTCCAGCTTTTTTACATGGCTAGACA ATGAACTGAACATGACGAGAACATGGATCTATGGATCTAGACAATAAGCT CATAAATAAAATATTACAAGTCTCAAAAGACTAGTACGTCTCAAAAGAAC TGAACATGACGAGAGACATGGATCCTCGTCATGGATCTAGACAATGATGC ATTTTGCTATTTGGCAGAACAGCAGTGTACAGAAAACACCCTTCACCTTG TCAACCTCCTCTGGCAACTAGTCCGGTACATGCCTACCAACAAAAAGAAT TAGGGTCCCAAAGAATTATTAGTTTCTGACACAAATTGTCACATATGGGG ATGAAAAAAATAATTGCAATCGTATAATATACTCCCTCCGTTCCAAATTA TAAGTCGCTTTGACTCTTTTGGTACATCCATTTTACTATGTATCTAGACA TAACGTATTTCTAGATACATAGAAAAATGGATGTACCAAAAAAGTCAAAG CGACTTATAATTTGGAACGGAGGGAGGAGTAATTAAACAATATGAAATTG AAGTATGAGACATGTTTGCCTCAATGCAACCAAACACTAAAAAAATACAG TTACACTGACACAAAATTGCATTATGGCAATTGTCCTCTTTTCAGAGGTT AAGGCAAACAAATCGAAACATCATTTATACTATATAATATCATAAAACTA ATGGGGATAAGTAACACCATTCAGTGGCACTATAGTTAAACAAATAATAA GATAACTCGACACTATATAGAGAGCAATCACAATCGGCATTCGGAAATCA CACACAAACAGCTTCAGAAGCATGCAAGAACTAGTAGTACTCAAATCAGT GTCTGGCTGTCTGCAAGATATGCTTTATGTAACAACAAAAAGTAGAAGAA TGAAGAGTAGACAGATAGGCCTGAAAGAACTTTACTCCCACTTCATAATA TATACCATTGCATAATCAATCTCCAAGGGTATGTTGACTTGCCAACATTA AAATTCATGAGTAAACTTACTATCAGTTAATTTAGAACTCCATGCAACTT CTTTTTAATAAAATGCCAAGAAAAAATATGTTTAAAGTTGAGTAATAGTA GAATAAACATGAACTGGTCAGACATGCATACTAACGATTATTTTGTAGAT TCAGCAATCTAGATTGGTCATGGTTGGTTTGCACTAGTTTGCTTGAGACT TGGGGAGATGTCTGGTAACTCAAACATAGTAATAGTCTAACAGAGATCGC TAGAAGCAAAAAGGAGAAAAGCCATTGAAATCGAAACATTATGGTTAATC GTGATAGCTTGATGCATAGGCTGCATGCTGATGCATTAACATTCAATGAT GAACTGATGCATAAACTGAATATTCAGTATGCTGCAAGCTCTCATACAAA CAATGCCTATGCCTACTGTTCTAGCTAGTGTAATTATGAGATTCATACTG AAAATTCACAAGTAGAAGCGCTCGTAATAGTCAGGGATGAAAATAGAATT CACAAAATTGAGTCTTCCTTGCCGGTGTAAGAAAATAATGAATAAACCAA TTAATCTCTCGTGGATAAAAATAATCGAGCTGGATCAAACAAGCGTCATA GAACCGGCCGCTGAACTAGGTAGAACGGAGACAGACAGAACATTGCCTCA CTGGTCACCGCGGAGGTCACACGGTGTGCTTGTCAACTCAAGAACCCTAC AGCATGGAAGAGGTGAGGGGAAACTTACAGGCGAGAAGGTGGCTACCTGA GGGGACGGCCACCGCCGTGAAGATCGCCGCGTTGCCGTTGTCGAAGCCTC CAAATCTTGCCGCCACCGAGATGCCGTTGTACCTCGCCTTCGTGGCGATG CTTCCCCTCGGCGCTCGTAGCCGACGCGTCCCGTGAAGCGCTCCAGCCGT CGCGAGCCCTCCGCAACGATGCGAGGACCTAGTGACCTGGCAGCAGGTTG TGCGTTCGCCTCCGTGGGGAATTGTTCCGTGACTCATGCGGAGTGGGTGG AAACCAGGCTGGGGTGGAGGGTAATCGCCTGGAATAGGACGGGGTAGAAT CTTCGGGTCGGCTAACCAAACGCCACTTTCACGGTGAGCCGGGCTTGAAT CCGCTTCGGGAGCATCCCTGTGGATCGGGCCGCGAACCCCGTGGGGAATG GCCTAACTGAACAAGGCCTTAAAGTAGATTGAGACTCTGTCCGATTATTA TTAAGAATACTGCAATGTTAAGAATATTTTTACCTACTCTCCTAAAGCCA CTATGCAAAATTGAGCTATACCTGTAATATTGCTATTAAATCCTCGAACT ATGGTCCATTTTACTTGCTTAAGACATCGTTAGTCTTGAGTGTGCATGCC TGGCTATTGCATTTTCTATATGTCAACAAAACAATAAAACTATAATCTAG CAGCACTTTGATATTACATTATTACTTTTTACACGACAAATTTAAGTACT TTTACATGTATTGGAAATTTGAAAGGTTTGACTTCACAGTCCACATATCC GGACAATATCAATTTTATTTGGAGATAAATTATTTTCTCACGTATATCTT ATATTCATATGTTTTCCAGATTAAAGCCATGGAGAGAAGGGGCATTGGAC TTTACAGTGATACACTTGCTGCTCTCTCAGTAGGGCATAGCAATAGTTCA CAGTTGGATTTGGCTGAGGAACTTTTGGAAAGAATTTCAGAGATAAAACC AAAGCATCTACGTGCCTTTAATGCTTTGCTTTCTGGATGTGCGATTATGG TAATGCATTGAATCTGGAAATAGATTTTATGATATTGGGTTTGTGTCCCT TGCGCTGAATCTGCAAATGCTTGATGCTCTACATAACGTCCACATCCACA GAAAGTAGTTTCCTATAGCTGTCACTGCACCAACCTGCCAAATTAAAGTT TCTGTTTCATTAATAAGAAGAATGAACTAAACCTCTCCTCCCCTTCCCCC CTTTTCTTGGCAGAATGAACCAGAAAGAGCTGTGCGCATACTAGCTAAAA TGAAACATGTGAACATGAAGCCAACTCTCAGGACATATGAACTTTTGTTT TCTCTGTTTGGAAATGTAAATGTTCCTTATGAAGAAGGAAATGTGCTCTC TCATGTTGATGTTTCCAAAAGGATAAGTATCATTGAGATGGACATGTTTA ACAATGGAATCCAACACAGCTTTGTGTCTATGAAGAACTTGGTAAGTCTT CTTTCTATGTACTGTAGAGATCTAAGATATTTGGCAATAGTATGTATCCA GTTAGGAACCAATTCCATTTGTTGGCCTTTTCACATTGTCCACATCATGC TTTAACTTGTCCGAATAGGAAAATAGCTGATTTATACTTGTCTTAATCTT CTCTGTTTCTATCTAAAATTCCCTGTGAACTGTGACAGTTATTACTTAAA GGTAATAAGTCCACTACTATTTCCAGTGGTCAATTTAGTATATTTTTATG GTAATCGGAAGCACCACCTGAAGAGGACATATCATTGTTGTTTTGTGAAA AGTCTGAATATTTTCTCGCCAGCTAGTTCCCACTGGATGTCATAACCCAA AATCTTGCCAGTTAGTTCTCACAGACAGTTTACTGATTGAATTATCATCA TGCCATCTATAAAAATTTCTGGTATTGTGGTTTAACTTGCCAGTCACATC CCTCAGTGCTTCTTATGCTGAAAAATCCTTTTAATGTTCTATTTATTCTG TTTCAGATACGAGCTTTTGGATCTGAGGGGATGATAGAGGAAATGCTGAG GTACCTGAATATAGCAGAAAATATTTTGTGGAACATAAATCCTTATCAGA AGAGTGATCTATACAGCATTGCGTTGCATGCTCTGGTTGATGCGAAGGAA GTACGTATCAACAACCTTTTAAGTTTGTTCCGATGTGACAAAATGAGGAT TATTTTATCTCTTCTCTTTGTAAGGCATGTAAATCTAGTTGTAACAGCTA TTTTAGCTCATTTAATCTCGCTGAATTTGATGGGGAGATCCCAAGTGCAG TCACCAGTTATGTTGTAGTTATGGTGTTATGCAACCACCAAAGAAATTTT AGTTACAGTGTTAAGCAATCACCGCTAAATTGGGCGTGGAATCAATAATA AAAAAATTTCTAAATAATTAAAGATTCATTCACTTTACTTGCTTACTTGC AAAATTCATGTTCAGATTGTTTCTGTGTTACGGATTATATAGCATACAGT TCTTTTCTTTTGTTCTATCTAAAGCTATAGTACATTTGGAGTTTTTAGTT GAAATTTGAAAGTACTCCCTCCGTTCCAAATTGTAAGTCGTTCTTGTCCT AAGTTAAACTTCTCTAGCTTTGACTAAGTTTATAGAAAAATGCATAAACA TCTGCAACATCAAACTAGATTCATTAGATACACCATGGTAGTTTGATATC GCAGATGTTAATGTACTTTTCTATAAACTTAGTCAAAGTTAGACAAGTTT GACTTAGGGCAAAGCTGAAACAACTTACAATTTGCAGTGGAGGAATTATG CTACAACACTCCATAGACTGTATATTGTCAAAGTTTTCGAATGGGAACTG GTTCATGTTGGTTTGGTACTTTGGTGCCAAACTGAAATTTCATTGCATGA CTGCATTTTGCAGATATTGAACTTGTGTTATAAATCTTGATCCATGTTTC TTTTCTGGTATGCAGACTCACAGAGCAGTAATGGTCTTCAAAATCATGAG ATCATGCAGCCTTCCAACTAATATTTCAATTTATAATACCATGATAGAGT GCTGCAAATGGCTGCAATGTTTCAAATCAGCTAGTGCTTTGCTGTCTTTG ATGCTCCAAGATGGCTTCAATCCTACGGTTGTGACTCTTACATCACTCCT GAAGGTAAGTCTGGCTAAGAATAATACATATGTCTTTTAGATCTATCATA TTACCGATTACATATTAGTTGGGTTGACTTTTAGTGGTCCGATTGATCTC ATGTCTTTTTCATGATGTAAGATAGGTTGTATTAGCAAATAATAATTTTG AAGGGGCTCTGGATCTGCTTGATATATGCAAGATTGAAGGACTTCAGCCT GACATACATATTTTCAACACAGTACTCTCACGTGCATATGCTAGAGTATG TTTATGA
back to top