Sh_001B06_g000110

Overview
NameSh_001B06_g000110
Unique NameSh_001B06_g000110
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length1950
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_001B06contigSh_001B06:112881..114830
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NotePentatricopeptide repeat-containing protein At3g62890
TypemRNA
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_001B06_t000110Sh_001B06_t000110R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_001B06_g000110 ID=Sh_001B06_g000110|Name=Sh_001B06_g000110|organism=R570 Sugarcane cultivar|type=gene|length=1950bp
ATGGGCCTGCACGGCCGAGCCTTCCACCTCATCCGGTGCGCGGGCGCGAC
GCACGGCACCTACGTGGGCCACGTCGAGGCGGGGCACGGCGGCCTCCTCG
CTCTCCTGCCGCCCTGCCGGCCGGGCGCAATCCAGGAGGCCGCGCGGCGC
GCGCAGTGCTCTCCCGCTCCACGTACACCGGGCACACGCTCCGCTGCCAG
AGCAATGCCGCCCGCTACCGTCCCCTTCTTCGTCACCTCCACCACGCTCG
CCACCGCCGCGATGAAACCGCAGCCGCAATCGCCGCCATGCGACGCGCAA
GCCCAGGCCGCCCAGGCCTCGGCGGCGTCTGCCTCGTACGCCGCGCGCAT
GCGGCTCAACCCGCACCTCGCTCTCCGCCTGTTCGACCACCTGCTCCGCT
CGGGCGCCGACCCGGACCCCGCGGCGTACGAGCTCGCTTTCGCGTCCTGC
GTGCGCGGGAGGGACCGTGCCACGGCCGCGCAGCTCCACGCCCACGCCGC
CAAGCGCGGGCTCGTCGCCTCGCACCGCCGCGTGCGCTGCAGGCTCGTCC
ACGCCTACGCCGTCTGCGGGATGCTCCCCCACGCGCGCAGGGTGTTCGAC
GGCGGGACCGACAACGACATGGTTGCCTGGAACTGCCTGCTGCGCGGGTA
CGCGCAGGAGGGCGGGGACGCGGGCTTGCTCCACGATTTCTTTGCCAGGA
TGCCGTCCCGGGACAGCGTCTCGTGGAACACAGTCCTTTCATGGTGCGTC
GTGAATGGGAAGTACGACGAGGCAATAGCCGTGTTCCGGGAGATGCTCGC
GAGCCAGGAGTGCCAGCCTGATAGGGTGACATTAGTGAGCGTTGTCTCTG
CAATTGCATACTTGGGGGCACTTGCACAGGGTCTCTGGGCACATGCATAT
GTCTTCAGGAAAGGTGTTGAAGTCGAGGAGAAACTGAGCTCAGCATTGAT
AAACATGTACTCAAAGTGTGGGTTCATTGAGGGTGCAGTTTATGTGTTTG
ACAATGTCCGAGGAAAGAGGAGCTTGGATACTTGGAATGCAATGTTAGCC
GGTTTTACAGCGAATGGTTGCAGTGAGAGAGCTCTGGAGCTCTTCACCAG
GATGGAGTCAACAGGGCTGATGCCTAATAAGATTACTTTTAACTGCGTAC
TGAATGCTTGTAGCCACAGGGGGTTAGTTGAGGAAGGTATGAGGTGTTTT
CAGAGAATGTCTAGAGTTTATGGTATCGAGCCTGACATTGCACATTATGG
TTGCATGGTGGATCTCTTCTGCCGTGCAGGGATGTTTGAGAAAGCTGAGA
AGATAATTCAGATAATGCCGATGGAGCCAGATGCTTCCATGTTGAAGGCC
CTATTGCGTGCTTGCAGAACTCATAAGAACTTAGAGGTGGGAAAGAAGGC
TGGCCATAGGCTTATTGAGGCTGCCCCAAATGATCACGCCGGGTATGTGT
TGTTATCCAACATATATGCACTAGATGGCAACTGGGGAGGAGTGCATAAG
GTGAGAAAGCTTATGTTGGATCGTGGCGTGCTGAAGACCCCTGGGAGCAG
CTCAGTGGAACTTAACGGTGTAATTCATGAGTTCATTTCTGGAGACAAAA
GCCACTCGAGGAAGAGGGATATATATAAGATGCTAGGTGAGATTTGTCAA
CAGCTTAAAAGTGCAGGATATACTCCTGACACTTCACAAGTGCTGCTAGA
CATTGACGATGAAGATGTGAAAGAGAGCTCACTAGCTCTACATAGTGAGA
AGCTTGCAATAGCCTTTGGACTGATCAGCACTGCTCCTGGGACGCCTATT
AGGGTAGTAAATAACCTCCGGATCTGCGGAGATTGTCATAATGCCATAAA
ACTTCTAAGCAAGATTTATGGGAGGTGCATAATTGTTAGGGATGCAAATC
GGTTTCATCATTTCAGAAAAGGGTCTTGTTCTTGCGGGGATTACTGGTAA
back to top

gene from alignment at Sh_001B06:112881..114830+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_001B06_g000110 ID=Sh_001B06_g000110|Name=Sh_001B06_g000110|organism=R570 Sugarcane cultivar|type=gene|length=1950bp|location=Sequence derived from alignment at Sh_001B06:112881..114830+ (R570 Sugarcane cultivar)
ATGGGCCTGCACGGCCGAGCCTTCCACCTCATCCGGTGCGCGGGCGCGAC GCACGGCACCTACGTGGGCCACGTCGAGGCGGGGCACGGCGGCCTCCTCG CTCTCCTGCCGCCCTGCCGGCCGGGCGCAATCCAGGAGGCCGCGCGGCGC GCGCAGTGCTCTCCCGCTCCACGTACACCGGGCACACGCTCCGCTGCCAG AGCAATGCCGCCCGCTACCGTCCCCTTCTTCGTCACCTCCACCACGCTCG CCACCGCCGCGATGAAACCGCAGCCGCAATCGCCGCCATGCGACGCGCAA GCCCAGGCCGCCCAGGCCTCGGCGGCGTCTGCCTCGTACGCCGCGCGCAT GCGGCTCAACCCGCACCTCGCTCTCCGCCTGTTCGACCACCTGCTCCGCT CGGGCGCCGACCCGGACCCCGCGGCGTACGAGCTCGCTTTCGCGTCCTGC GTGCGCGGGAGGGACCGTGCCACGGCCGCGCAGCTCCACGCCCACGCCGC CAAGCGCGGGCTCGTCGCCTCGCACCGCCGCGTGCGCTGCAGGCTCGTCC ACGCCTACGCCGTCTGCGGGATGCTCCCCCACGCGCGCAGGGTGTTCGAC GGCGGGACCGACAACGACATGGTTGCCTGGAACTGCCTGCTGCGCGGGTA CGCGCAGGAGGGCGGGGACGCGGGCTTGCTCCACGATTTCTTTGCCAGGA TGCCGTCCCGGGACAGCGTCTCGTGGAACACAGTCCTTTCATGGTGCGTC GTGAATGGGAAGTACGACGAGGCAATAGCCGTGTTCCGGGAGATGCTCGC GAGCCAGGAGTGCCAGCCTGATAGGGTGACATTAGTGAGCGTTGTCTCTG CAATTGCATACTTGGGGGCACTTGCACAGGGTCTCTGGGCACATGCATAT GTCTTCAGGAAAGGTGTTGAAGTCGAGGAGAAACTGAGCTCAGCATTGAT AAACATGTACTCAAAGTGTGGGTTCATTGAGGGTGCAGTTTATGTGTTTG ACAATGTCCGAGGAAAGAGGAGCTTGGATACTTGGAATGCAATGTTAGCC GGTTTTACAGCGAATGGTTGCAGTGAGAGAGCTCTGGAGCTCTTCACCAG GATGGAGTCAACAGGGCTGATGCCTAATAAGATTACTTTTAACTGCGTAC TGAATGCTTGTAGCCACAGGGGGTTAGTTGAGGAAGGTATGAGGTGTTTT CAGAGAATGTCTAGAGTTTATGGTATCGAGCCTGACATTGCACATTATGG TTGCATGGTGGATCTCTTCTGCCGTGCAGGGATGTTTGAGAAAGCTGAGA AGATAATTCAGATAATGCCGATGGAGCCAGATGCTTCCATGTTGAAGGCC CTATTGCGTGCTTGCAGAACTCATAAGAACTTAGAGGTGGGAAAGAAGGC TGGCCATAGGCTTATTGAGGCTGCCCCAAATGATCACGCCGGGTATGTGT TGTTATCCAACATATATGCACTAGATGGCAACTGGGGAGGAGTGCATAAG GTGAGAAAGCTTATGTTGGATCGTGGCGTGCTGAAGACCCCTGGGAGCAG CTCAGTGGAACTTAACGGTGTAATTCATGAGTTCATTTCTGGAGACAAAA GCCACTCGAGGAAGAGGGATATATATAAGATGCTAGGTGAGATTTGTCAA CAGCTTAAAAGTGCAGGATATACTCCTGACACTTCACAAGTGCTGCTAGA CATTGACGATGAAGATGTGAAAGAGAGCTCACTAGCTCTACATAGTGAGA AGCTTGCAATAGCCTTTGGACTGATCAGCACTGCTCCTGGGACGCCTATT AGGGTAGTAAATAACCTCCGGATCTGCGGAGATTGTCATAATGCCATAAA ACTTCTAAGCAAGATTTATGGGAGGTGCATAATTGTTAGGGATGCAAATC GGTTTCATCATTTCAGAAAAGGGTCTTGTTCTTGCGGGGATTACTGGTAA
back to top