Sh_001C11_g000060

Overview
NameSh_001C11_g000060
Unique NameSh_001C11_g000060
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length8671
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_001C11contigSh_001C11:82706..91376
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NoteProtein DETOXIFICATION
TypemRNA
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_001C11_t000060Sh_001C11_t000060R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_001C11_g000060 ID=Sh_001C11_g000060|Name=Sh_001C11_g000060|organism=R570 Sugarcane cultivar|type=gene|length=8671bp
CCCCAAGCGTCGATGGTTGAAGGGGCTGGGCAGCTCCCTAGGGGCAAGCG
GTGGATGTCGGCACGATCGTGCCTACGGCGTCCAACCACGCGGCCCAACT
ATCCCAAGCTCGCAATCGGGCGCACCGGCCAAGAACTCAGGCAGCAGCGC
ACAGGCCGTAGGCTAGCTGGCCGCCAGGCGCAGCCACTGTGTCCCCTGCC
GCTTGCGGCGCACTGGGTAAAGACGGATAACTGCTAGCCACGGCTGCCAC
TATCGGCTTGCCGCGCGAGTCCTGCTCGCCGAGCGCTGGCGCCGACCGCC
GAGTCGTTCCCAAATCGACTCTCTACTGCCCAAATCGAAATCTCCCTCTA
CCAAATCGAGTTTTCGATGCTGAGATCAAGGTACCCTATATATGTTTAGT
TTACAGTATGAAATGTTAGTCAAAAAGTAAAGCCATCCCCCAAAAAAAAT
ACAACGCATAGTTCTTAGTCAAACTATGATAAGTTTTGGCGTGATTATAC
AAAAATGCTATAAGTATTTATGGTAACAAATTTGTATTATTAGATTCAAA
ATATACCTTTTAGAGTTATAAATATAGTCATATAGATCATATTTCCTATA
AATTTTAAACAAACTTAAAATAGTTTGACTAAAGATAAGACTAGAGTTAG
CATTTTTTTTTCTTGGGACGGAGGAGACATATAAATTATTCGTCGATCTC
TCTCACACACCACTAGATCTAGCCAATGGCAGTGGTTCTTCCCAGCTGCT
CCACTGTCGGGATTTAGAGATACTGGTCGAGAGTAGGCCAATCTCTGCCA
CAGAGCAACAAGATCGAGGACAATAATTTGAACTAATCACACCAGACTAA
GCATGGTGAAGGAAATAAAAAACAATTTACAGATGCCTACCATCTCATCA
AGCACAAAAAACAAAAACACGAAATAGTAAAATGCTCAGCGCTGATAATA
AGTGTGTCCGGTGTTTGTGTCCTATTTTTTTGAAAACTGTGTTTGTGTCC
TATTCATTAGTACCTATTTAGCTATTTGTTGCGCTCTCTCTCTCTCGTGA
GCTCTACTAGCTACATAAGCAGAAGATATATGGCCGTCGGCGGCGATGGT
GAAGGCGGGACGTCGTCGTCGTCGTCCCATGAGCTGAGCGGGCAGCTGGA
GGGCATCCTCGCCGACCGTGAGGCGCCATGGGCGCGCCGGGCGTCCAAGG
CAGCCATGATAGAGCTCCGGCTGCTGGCGCCAATCGCGGCGCCGGCGGTG
GTGGTGTACGTGCTCAACAACGTGCTGTCCATCTCGACGCAGATCTTCTC
GGGGCACCTCGGCAACCTGGAGCTCGCTGCCTCGTCGCTCGGGAACAACG
GGATCCAGGTCTTCGCCTACGGCCTCATGGTATGGGTATTACTAGCTCAT
CTCACAGATCGAGTACTCTCTGTAGCTTCAGCACAGCATCCATGCCTGCA
TTCGTGTGAGGCATGGATCCGATCGATCCGTTGCATTTGTTTCATTCCGA
CAGATCGAGCGCAGTTTCTACTATGTTTACCTTTTATTCTTCATAAATAT
ACTACTCCTATATATACCAGATGGGTGAGAGAGATCCAGAATTACGAGGA
ATGCGAGAAATGTATTCTTTCGTGGACCCTACGAAACGGATGACATAGTC
CAATTTAGACCTGCATCTATACGCTGAAACATCTCACCAAGCTGCATCAT
TTTCATACATTGCTCGTCCTTCATTTTTTTTCAAAACACTATACAAACCA
CAAATGCTTGCATCAAGGTACATAATAAACTCATCTCTATAAAAACACGC
ATGCACATGCAATCAAACTACACATTCAACTATTCAAGAGAGTGAAGTGA
ACAATTTTAAAATTGATGAGGCCATAATAGATGTCTCACTGTTGCCGTGC
GTGTATTTATACACTTAGCCAGTAGGCGATGCGACTTAAAATTGAGCCGG
GTAGTATATATAAAAAAACTACGCTACAGTCGGATTAAGCTGGTGACACT
GGCGGTTGTGCTCTCGGACATCGTACTGGACAACTGCACAAACTTTCCAT
GCGTTAGGTACACACATTATTGTCTTCTAATATAGTCACTGATGTCCTCT
ATATATTTTGCCTGCATAGTATCTAGTCCAGCTGAAGTCTATATAATACA
TAGATTTTATATTCAAGCGTGGGCAGTCAGCTATGGGTTCTATTATTATA
TATATAATATAATATATGATATGATACAGGTAAGGCTGGCTAACGAGCCA
GCTCGGCTCGGCTCGTTCTGGCTCGTTAGGCTCGCGAGCCACGGAAAAAA
AATACAAAATATAATATTTGTATTTATCTAAAGCATAAAAATATTAATAA
TATAAAAATAATATATTCAATAGCCTTAAATCGAACAAAATATTCATATG
AGCTAACATATCATCTATTTGTGAAGTGCAAAACATGAAGTAATACAAAA
CTAATATAAGTTATGATGACTTTTTCTCTAAAACTACGGCTCGTTTGGCT
CGCGAGCGGCTCACGAGCCAGCTCGAGTTGGCTCGTTATAGCTAACGAGC
TAAAATCCTGGCTCGGCTCGGCTCGTTATCATAACGAGCCGAGCCGAGCT
GAGCCGAGCGAGCTAACGAGCTTCGAGTTTTTCGTCCAGCCTTAGATACA
GGTAGTAATATGAAAGGATGTACTAGCTGACTAATATTGTTGGATGGATG
TGATTGTTTTTTTTAATGAAAACTACGGAGGGGAGAGTTTCCCGCCTGGC
TTATATATATTAAAGAAGCGAAAGTGTTTAGTTACAACACTGAGGGATGT
GATTGTTATAAAGATACTGTGTATTTGTGAAACGTAAGTTATTTTGTTTT
ACTCGACCATGGTGATAGGGTTATTTAGCATAGTTATCGATTCCGTTCCG
GTACCGCCCGGAACGGCCGGTATGCCCTCGTACCGTCGCGCACACCGGAA
CAGAAGAAGCTGCGTCCCGTACCGGCCTTTATATCGGTCGATTCCGAACA
TCTCGGACGATTCCGGCCATTCCGGGTGGGATCAATCGTTTCATCCATGC
CGGTACCGTCGTCGCCGTTGTCGAGGAAGAAGATGCTCGAGTCCTGTTCT
TCGGCCTCGCTGAAACGCTCACGACATGGACGACTGCTCGAGGCCTGCTC
TTGCACTCCGGCTCTGCTGATGCGGAACGCCCAGGGCCATGGACGACCGC
TCGAGTTCTTGCGCTCCAGCTTGCTGATGCCGAGCGGCTAGGCTCATGAT
GACTCCTCACCACCGTGACGAGTGACAACGCTCGCACTCCAGAACTCAAC
ACTCATGGCTTCCTTCTTTACTTTGCTGCCTTGCTAGTTGGAACTTGGAA
CCGGAGATCTGGAGGTAGGCGGCGCCGAAGCAAATGTTGTGTTCGTCAAA
CCTGGACATGAAGCTGTGATTGAATTCCATTGAATGATGAGTGGCCGGGT
CCATGTTGAGAGGAAGGTAACAGGTAACAGCCCAAGGCATACTGGCAGGC
CGGCCCAAGCTCCCGTTGTTGTATTTTTATGAGATAATATTTACCCGTGT
GATTTCTCATATTTTAAAAAAACTCATATACATTCCAAATAAAATCTAAA
TAATTAATAAATTAATAAATTAATAAAACCGAAACGGTACACCGGAATGC
ACCGGTACCGAAACGTACCATTCCAACGACAAATCCGGAATGGTCTCCGG
AATGGAATTGATAAGTATGTTGTTTACACGGAGACAATTTCTTGTACATG
GGGAGAAAACGATTGAGTAGATGGGACATACTTTACTATCAAAAATATTG
CTGACATGCCTGAATAAGAATATCGAATAAAAAATTAGCGGCGGAGTGAG
TTCCTTGGTTTCCCACCTTTTCTTTTTCTTTTGTGGAGATATATTCGTGA
CAGGTGAACACAGATTCAGCAACTTTGCTTCGTGAAGTCACCACGCGTAA
CTTTATGTCTACGATCCACAGGCTAGGGGAGAACTTTATGTCTGTAGCTT
GATTTTTTCACATAACACAGCTCGGTAATGTTGTAACATGAGCATCTGTT
CGTCTGGACGCGACCGCAAGCGCTGGTGGAGGGCGGGCCTACGTGCGCCG
CCATGCTGTCGTTCTGCCGCCGTCACCACCAATACTTGGCGGCCTTAGAA
AGTTGTGGGGCCTGGGGGCAGCGCGGCTAGGTAGACAGTGGCGACGGTTC
GGCCGACGACAAGCTCGGCGGCAATGGTGCCACCGAGCTGGCGCAGCCGG
ACAACCGGTGGGCGGTGCCGGCGGCGGGGTGACAATAGCTTAGGTCGCCG
GAGGATTAGGATTAGGGAAAGGCGGGGAAGGAGCGGCGGGGATGGTCGAC
CAGCGGTGAGGTTGCCGGCGAGGTAGCCGACGGCCAGGGTGGGGTCAAAG
GTGGTGGCGAGTAGGGAGGAGGAGGAAGACGTCTAGACGTTGCGTCCGTC
CGAACGTCTAGGCGCTAGCTGCGCCGTTGACTTTGCCGCCGTGCCGGATG
ACCCGTGTGCAGTATCACCCGTCCTGCACGGCGCCTCACCTGCTATCGTG
CCTGCCACACCGGCCATCCCGGCCTCCTCGTCACATCGCCTACTAGCTCA
GTCGGCTATCCGCCCCGTTGACGTGCCGGTCATCCTTCCCCGTCACCCCC
AGCACAGACTGGAGCCTAGGTTGTCATGCATGCCTAGAACGCCACCAGGC
ACCAGCCTAGGTGATTGTGTAAAGGCATCAATTACTATGCCGAGCAGAAT
ATGTGTGAATAGTGGTTCAGAGAATATTTGAGTGGACTAAGGCCAATTTT
TCATTAGAATTTCATAGGTATTAAATAAGCTAACGTAGTACTCCAATACA
GTTAAATAAAGAAAAAGATGATACAAGTTTTATGGGATGAAATGAGTTCT
ATGGGTGATGAAACTCGTTTACACTATTTCCAATATATGAGTCTTGAAAA
CTGAGACGTGAAACTCTCACTGAGACTAGCCTAAAAACTAAGTCTGTTGG
AAGGGTGGAGATGTTGGACCTCAAATAGACATAGATGTATGCAAAGTTAC
CCAGGGATACGAAGCAAAGTCAACCAATATGTGTCTGTGATAACTGCCCA
CGGTGTCCATGCATGGGACTGTTAACAAGAGTCCAACATAGGGGTGTGCC
TGGTTACGGACATGATAGTCCGGTTAACTCCCTGACTGATTCTCTAAATC
AGCCAGGGGCTCGGGGGCGTACACCCATCGTGTACGCTCGTGTGTACACT
CCGGGCCATCTGCAGATGGATTGGTGGGCCTGTGAGGGCCTACTCCTGAG
AAGGCCTCGGCGATCAAGAGGCAAGACCAAGACACCTTGTCCTTGTCTAA
AGCCGTCTCTTGCTCGGGCCTCGGCCAAGGCACGAGGAAATCCTGACCCA
GGAGAGCCCCGGCCGAGCCAAGAACCCCCTTAGTCTCCCCAACCTTGGCT
CATGGTGACCATTCGCCCCAGGTGAACCTAGAAGCTAGCTCCGGAATCTG
TCAGGCACTCAAAGCATGATAGGCACAGAAGCACCACAACGCCATCCCGC
TCCTGCGAGGCATTGTCGGCCACCGTTTCGGCAGGGTCATGTCCGGGGCG
TGGTGTGTTAGGACAAGGAACTCCCCCAAGCCCACGAAGTGGGGGGGCTC
TGGGCTCGCTTGGCAGCCCCTCCGGGCAGTGGGAGGAGCATGGCGTGCCA
AAGAAGCTTGGAGAAGGCTCACTTAGGGAAGGCACCGTTACGATAGACAA
CACCTGGTGGTTAGCAGTAGGCTGTTGCAGTTATATCAAGGAGTGATTGT
AGTTTTGTCGGCCCCCAGCTACAAGACAAAGGAGGACTCAGCGACGCCAA
GACGAAGAAGAAGACTGAAGCCTAGGGCAAAAAAACCCTAGGATGAAGCA
TCCATCTTGTATTCCCTATGGGGAGGGCATGGACTCCTGTAGAAAGGGAA
TCGAACCTTATGAGACAGGACCAATCAAAATCCTAGATAAATTAGCATAA
TGCTTCCCCTGTACCCCACTCTCGATTTACTCCATTGTAAGAACTAACGA
TGGAGCATTCCTAACACGAAGAACACCACTATTAGACGTAGAACTTAGAG
GCCTGAACCATGATATATCCCTTGTGTTTTTTACTGTTTTGAGTGCTCGA
GGCCACCGATGGCACACGCATCGACCCAAGTCGAACAACCTAATGATTGT
CGTGCTTAGGAACCCACGCGACAACTGTCCTTACGGATTTTTTTTCTCTT
TTTGAGACCATATCATCACTGTTGAAAATGTCAATTACAGTACTTGCAAA
ACCAGGAAAGTAGTAACTTTTAAGGGTCACTACTACAAAATTAGGTTTTC
GAGATGACACCTTTTATTTTCAGATGCGATATAAAAGGGTCCGCCTCTAC
TGTGTAGCCCTTTTTACATTTTCATATTCCTTGGTCACCAATGTGTCTAG
TTTTCAATGTAAAACGTGACTTTTTTTTCTGAAATATAATACAACTGTGC
AGCTTGGCATGGGGAGTGCCGTGGAAACCCTGTGCGGCCAAGCCTACGGC
GCACACAGGTACGAAATGCTGGGCATCTACCTGCAGCGCTCGACCATCCT
GCTCGTCGCCGTGGGCGTGCCGCTCAGTGTCATCTACGCCTTCTCCGAGC
CCATCCTCGTCTTCCTCGGTGAGTCTCCGGAGATCGCCAAGGCCGCGGCC
GTCTTCGTGTACGGCCTCATCCCGCAGGTCTTCGCGTACGCGGCCAACTT
CCCCATCCAGAAGTTCCTGCAGGCGCAGAGCATCGTGGCGCCCAGCGCCT
ACATCTCCGCGGCGACGCTGGCGCTGCACCTGCTGCTGGGGTGGCTGGTG
GTGTACAGGCTCGGCATGGGCCTCCTGGGCGCGTCGCTCGTGCTGAGCCT
GAGCTGGTGGATCATCGTCGCCGCACAGTTCCTGTACATTGTCACCAGCG
AGCGGTGCCGGCGGACGTGGACGGGGCTCTCCTGCCGGGCGTTCTCGGGC
CTGCTGGAGTTCCTCAAGCTGTCGACGGCGTCGGCTGTGATGCTGTGCCT
TGAGACGTGGTACTTCCAGATCCTCATCCTCATCGCCGGCCTCCTCGACA
ACCCTCAGCTCGCCCTCGATTCACTAACAGTCTGGTACATTTCCGACAGC
ATATCGAAAGATACCGTCTGCAGTTTGCATGCATGCATGTATTACGTACT
CAATCAATTGCTTTAATTTTGTTTTGTTGGACAGTATGACGCTTGCTGGA
TGGGTGTTCATGATCTCCATTGGGTTCAATGCTGCTGCGAGGTGAATACT
GAATCATAGTATCTGTTAATGTACATTTATATACACGTTCTACTTCTACC
TGTTTCCATATATAACTACCACTACTGTCGTCTGCGTTTGCATCACTACT
ACTACTAGTGTGAGAGTTGGGAATGAGCTCGGAGCCGGGCACCCGCGGGC
AGCGGCGTTCTCTGTGGTGGTGGTGACCGCTCTGTCGTTCGTGATCACTC
TGGCCATGGCGGTGGTGTTCCTCGTCTTCCGCGACTACCTCAGCTACATC
TTCACGGAGGGGGAGACGGTCGCCCGCGCCGTCTCCGACCTCTGCCCTCT
CCTCGCCACCACGCTCATCCTCAACGGCATCCAGCCCGTCCTCTGCTCTG
CGTCTAAAATAAACTCGTTTTGTCGTCTATGGTCACCAGGTGTAGCTGTC
GGCTGTGGCTGGCAGAAACTCGTCGCGTATATAAACGTCGGTTGCTACTA
CTTCGTGGGCATCCCTCTCGGCATTCTTCTCGGCTTCAAATTCCATCTTG
GAGCAAAGGTATACTTCAGTTTCTAGTGACTAACCATATACATATGCTCA
TATTGCAGTATGATGCAGAGCAAATTTACTTGCTCCGATCCTTGCAGGGA
ATATGGACTGGGATGCTCGGTGGCACATGCATGCAGACGCTTATCTTGTT
CTGGATCACTTTTAGGACAAATTGGAACAAAGAGGTTTGTATGTACAGTA
CATATATAGGCGCCAATAAACGGATCGGAGACCATACTAATTATCTTTGC
TGTGACTCAAGAAGATAAATTATTCCGATGGCTAAAGGGGAGCATTCCAC
ACAGTATGAGGGTGCACATATGCAAAATTAATCTAAAATTAGGCTTAAAG
TATTTTTTTTGAAGAGCAAATCATGTTTTGATACCATAATATATTTTTAA
GCCTAAAATTCGAGAAATAAGGATAGCATATGGGCCTCAAAATGGTCCAA
AACATAACCTAGCGATGGCAGTGCAGAGATACCGATGAACAATAGAACTG
AGTATGAGGGAATTAGATAGGCATCTTATAGGTTTTTGTGTTCTTCATGT
CTTACGTGTTTTTGTGCAGGGTTTTTTTTTTACAACAGTTTTTGTGCAGG
TTGAGGAAGTCAGGAAGAGACTGAACCAATGTGAGGACAATAAGCAGCCT
CTTCTGCTAGTTCCCTCGGATTAACTCACGAGAATCAATTGCTTGTGGTT
GTTGGATTTTTTTTATGTATGGCTTTCAATATTTATTATTACAATTATTT
ATCACCTCTATGTGTGGAAATACTATTGATATATTTGGTTGATAGTTAAT
AATGAACTCGAGGAATTTGTAGTCGAGGTGCCAAGGACATTTGTGCTGGA
ATACAGTATTGAGGAATAATT
back to top

gene from alignment at Sh_001C11:82706..91376+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_001C11_g000060 ID=Sh_001C11_g000060|Name=Sh_001C11_g000060|organism=R570 Sugarcane cultivar|type=gene|length=8671bp|location=Sequence derived from alignment at Sh_001C11:82706..91376+ (R570 Sugarcane cultivar)
CCCCAAGCGTCGATGGTTGAAGGGGCTGGGCAGCTCCCTAGGGGCAAGCG GTGGATGTCGGCACGATCGTGCCTACGGCGTCCAACCACGCGGCCCAACT ATCCCAAGCTCGCAATCGGGCGCACCGGCCAAGAACTCAGGCAGCAGCGC ACAGGCCGTAGGCTAGCTGGCCGCCAGGCGCAGCCACTGTGTCCCCTGCC GCTTGCGGCGCACTGGGTAAAGACGGATAACTGCTAGCCACGGCTGCCAC TATCGGCTTGCCGCGCGAGTCCTGCTCGCCGAGCGCTGGCGCCGACCGCC GAGTCGTTCCCAAATCGACTCTCTACTGCCCAAATCGAAATCTCCCTCTA CCAAATCGAGTTTTCGATGCTGAGATCAAGGTACCCTATATATGTTTAGT TTACAGTATGAAATGTTAGTCAAAAAGTAAAGCCATCCCCCAAAAAAAAT ACAACGCATAGTTCTTAGTCAAACTATGATAAGTTTTGGCGTGATTATAC AAAAATGCTATAAGTATTTATGGTAACAAATTTGTATTATTAGATTCAAA ATATACCTTTTAGAGTTATAAATATAGTCATATAGATCATATTTCCTATA AATTTTAAACAAACTTAAAATAGTTTGACTAAAGATAAGACTAGAGTTAG CATTTTTTTTTCTTGGGACGGAGGAGACATATAAATTATTCGTCGATCTC TCTCACACACCACTAGATCTAGCCAATGGCAGTGGTTCTTCCCAGCTGCT CCACTGTCGGGATTTAGAGATACTGGTCGAGAGTAGGCCAATCTCTGCCA CAGAGCAACAAGATCGAGGACAATAATTTGAACTAATCACACCAGACTAA GCATGGTGAAGGAAATAAAAAACAATTTACAGATGCCTACCATCTCATCA AGCACAAAAAACAAAAACACGAAATAGTAAAATGCTCAGCGCTGATAATA AGTGTGTCCGGTGTTTGTGTCCTATTTTTTTGAAAACTGTGTTTGTGTCC TATTCATTAGTACCTATTTAGCTATTTGTTGCGCTCTCTCTCTCTCGTGA GCTCTACTAGCTACATAAGCAGAAGATATATGGCCGTCGGCGGCGATGGT GAAGGCGGGACGTCGTCGTCGTCGTCCCATGAGCTGAGCGGGCAGCTGGA GGGCATCCTCGCCGACCGTGAGGCGCCATGGGCGCGCCGGGCGTCCAAGG CAGCCATGATAGAGCTCCGGCTGCTGGCGCCAATCGCGGCGCCGGCGGTG GTGGTGTACGTGCTCAACAACGTGCTGTCCATCTCGACGCAGATCTTCTC GGGGCACCTCGGCAACCTGGAGCTCGCTGCCTCGTCGCTCGGGAACAACG GGATCCAGGTCTTCGCCTACGGCCTCATGGTATGGGTATTACTAGCTCAT CTCACAGATCGAGTACTCTCTGTAGCTTCAGCACAGCATCCATGCCTGCA TTCGTGTGAGGCATGGATCCGATCGATCCGTTGCATTTGTTTCATTCCGA CAGATCGAGCGCAGTTTCTACTATGTTTACCTTTTATTCTTCATAAATAT ACTACTCCTATATATACCAGATGGGTGAGAGAGATCCAGAATTACGAGGA ATGCGAGAAATGTATTCTTTCGTGGACCCTACGAAACGGATGACATAGTC CAATTTAGACCTGCATCTATACGCTGAAACATCTCACCAAGCTGCATCAT TTTCATACATTGCTCGTCCTTCATTTTTTTTCAAAACACTATACAAACCA CAAATGCTTGCATCAAGGTACATAATAAACTCATCTCTATAAAAACACGC ATGCACATGCAATCAAACTACACATTCAACTATTCAAGAGAGTGAAGTGA ACAATTTTAAAATTGATGAGGCCATAATAGATGTCTCACTGTTGCCGTGC GTGTATTTATACACTTAGCCAGTAGGCGATGCGACTTAAAATTGAGCCGG GTAGTATATATAAAAAAACTACGCTACAGTCGGATTAAGCTGGTGACACT GGCGGTTGTGCTCTCGGACATCGTACTGGACAACTGCACAAACTTTCCAT GCGTTAGGTACACACATTATTGTCTTCTAATATAGTCACTGATGTCCTCT ATATATTTTGCCTGCATAGTATCTAGTCCAGCTGAAGTCTATATAATACA TAGATTTTATATTCAAGCGTGGGCAGTCAGCTATGGGTTCTATTATTATA TATATAATATAATATATGATATGATACAGGTAAGGCTGGCTAACGAGCCA GCTCGGCTCGGCTCGTTCTGGCTCGTTAGGCTCGCGAGCCACGGAAAAAA AATACAAAATATAATATTTGTATTTATCTAAAGCATAAAAATATTAATAA TATAAAAATAATATATTCAATAGCCTTAAATCGAACAAAATATTCATATG AGCTAACATATCATCTATTTGTGAAGTGCAAAACATGAAGTAATACAAAA CTAATATAAGTTATGATGACTTTTTCTCTAAAACTACGGCTCGTTTGGCT CGCGAGCGGCTCACGAGCCAGCTCGAGTTGGCTCGTTATAGCTAACGAGC TAAAATCCTGGCTCGGCTCGGCTCGTTATCATAACGAGCCGAGCCGAGCT GAGCCGAGCGAGCTAACGAGCTTCGAGTTTTTCGTCCAGCCTTAGATACA GGTAGTAATATGAAAGGATGTACTAGCTGACTAATATTGTTGGATGGATG TGATTGTTTTTTTTAATGAAAACTACGGAGGGGAGAGTTTCCCGCCTGGC TTATATATATTAAAGAAGCGAAAGTGTTTAGTTACAACACTGAGGGATGT GATTGTTATAAAGATACTGTGTATTTGTGAAACGTAAGTTATTTTGTTTT ACTCGACCATGGTGATAGGGTTATTTAGCATAGTTATCGATTCCGTTCCG GTACCGCCCGGAACGGCCGGTATGCCCTCGTACCGTCGCGCACACCGGAA CAGAAGAAGCTGCGTCCCGTACCGGCCTTTATATCGGTCGATTCCGAACA TCTCGGACGATTCCGGCCATTCCGGGTGGGATCAATCGTTTCATCCATGC CGGTACCGTCGTCGCCGTTGTCGAGGAAGAAGATGCTCGAGTCCTGTTCT TCGGCCTCGCTGAAACGCTCACGACATGGACGACTGCTCGAGGCCTGCTC TTGCACTCCGGCTCTGCTGATGCGGAACGCCCAGGGCCATGGACGACCGC TCGAGTTCTTGCGCTCCAGCTTGCTGATGCCGAGCGGCTAGGCTCATGAT GACTCCTCACCACCGTGACGAGTGACAACGCTCGCACTCCAGAACTCAAC ACTCATGGCTTCCTTCTTTACTTTGCTGCCTTGCTAGTTGGAACTTGGAA CCGGAGATCTGGAGGTAGGCGGCGCCGAAGCAAATGTTGTGTTCGTCAAA CCTGGACATGAAGCTGTGATTGAATTCCATTGAATGATGAGTGGCCGGGT CCATGTTGAGAGGAAGGTAACAGGTAACAGCCCAAGGCATACTGGCAGGC CGGCCCAAGCTCCCGTTGTTGTATTTTTATGAGATAATATTTACCCGTGT GATTTCTCATATTTTAAAAAAACTCATATACATTCCAAATAAAATCTAAA TAATTAATAAATTAATAAATTAATAAAACCGAAACGGTACACCGGAATGC ACCGGTACCGAAACGTACCATTCCAACGACAAATCCGGAATGGTCTCCGG AATGGAATTGATAAGTATGTTGTTTACACGGAGACAATTTCTTGTACATG GGGAGAAAACGATTGAGTAGATGGGACATACTTTACTATCAAAAATATTG CTGACATGCCTGAATAAGAATATCGAATAAAAAATTAGCGGCGGAGTGAG TTCCTTGGTTTCCCACCTTTTCTTTTTCTTTTGTGGAGATATATTCGTGA CAGGTGAACACAGATTCAGCAACTTTGCTTCGTGAAGTCACCACGCGTAA CTTTATGTCTACGATCCACAGGCTAGGGGAGAACTTTATGTCTGTAGCTT GATTTTTTCACATAACACAGCTCGGTAATGTTGTAACATGAGCATCTGTT CGTCTGGACGCGACCGCAAGCGCTGGTGGAGGGCGGGCCTACGTGCGCCG CCATGCTGTCGTTCTGCCGCCGTCACCACCAATACTTGGCGGCCTTAGAA AGTTGTGGGGCCTGGGGGCAGCGCGGCTAGGTAGACAGTGGCGACGGTTC GGCCGACGACAAGCTCGGCGGCAATGGTGCCACCGAGCTGGCGCAGCCGG ACAACCGGTGGGCGGTGCCGGCGGCGGGGTGACAATAGCTTAGGTCGCCG GAGGATTAGGATTAGGGAAAGGCGGGGAAGGAGCGGCGGGGATGGTCGAC CAGCGGTGAGGTTGCCGGCGAGGTAGCCGACGGCCAGGGTGGGGTCAAAG GTGGTGGCGAGTAGGGAGGAGGAGGAAGACGTCTAGACGTTGCGTCCGTC CGAACGTCTAGGCGCTAGCTGCGCCGTTGACTTTGCCGCCGTGCCGGATG ACCCGTGTGCAGTATCACCCGTCCTGCACGGCGCCTCACCTGCTATCGTG CCTGCCACACCGGCCATCCCGGCCTCCTCGTCACATCGCCTACTAGCTCA GTCGGCTATCCGCCCCGTTGACGTGCCGGTCATCCTTCCCCGTCACCCCC AGCACAGACTGGAGCCTAGGTTGTCATGCATGCCTAGAACGCCACCAGGC ACCAGCCTAGGTGATTGTGTAAAGGCATCAATTACTATGCCGAGCAGAAT ATGTGTGAATAGTGGTTCAGAGAATATTTGAGTGGACTAAGGCCAATTTT TCATTAGAATTTCATAGGTATTAAATAAGCTAACGTAGTACTCCAATACA GTTAAATAAAGAAAAAGATGATACAAGTTTTATGGGATGAAATGAGTTCT ATGGGTGATGAAACTCGTTTACACTATTTCCAATATATGAGTCTTGAAAA CTGAGACGTGAAACTCTCACTGAGACTAGCCTAAAAACTAAGTCTGTTGG AAGGGTGGAGATGTTGGACCTCAAATAGACATAGATGTATGCAAAGTTAC CCAGGGATACGAAGCAAAGTCAACCAATATGTGTCTGTGATAACTGCCCA CGGTGTCCATGCATGGGACTGTTAACAAGAGTCCAACATAGGGGTGTGCC TGGTTACGGACATGATAGTCCGGTTAACTCCCTGACTGATTCTCTAAATC AGCCAGGGGCTCGGGGGCGTACACCCATCGTGTACGCTCGTGTGTACACT CCGGGCCATCTGCAGATGGATTGGTGGGCCTGTGAGGGCCTACTCCTGAG AAGGCCTCGGCGATCAAGAGGCAAGACCAAGACACCTTGTCCTTGTCTAA AGCCGTCTCTTGCTCGGGCCTCGGCCAAGGCACGAGGAAATCCTGACCCA GGAGAGCCCCGGCCGAGCCAAGAACCCCCTTAGTCTCCCCAACCTTGGCT CATGGTGACCATTCGCCCCAGGTGAACCTAGAAGCTAGCTCCGGAATCTG TCAGGCACTCAAAGCATGATAGGCACAGAAGCACCACAACGCCATCCCGC TCCTGCGAGGCATTGTCGGCCACCGTTTCGGCAGGGTCATGTCCGGGGCG TGGTGTGTTAGGACAAGGAACTCCCCCAAGCCCACGAAGTGGGGGGGCTC TGGGCTCGCTTGGCAGCCCCTCCGGGCAGTGGGAGGAGCATGGCGTGCCA AAGAAGCTTGGAGAAGGCTCACTTAGGGAAGGCACCGTTACGATAGACAA CACCTGGTGGTTAGCAGTAGGCTGTTGCAGTTATATCAAGGAGTGATTGT AGTTTTGTCGGCCCCCAGCTACAAGACAAAGGAGGACTCAGCGACGCCAA GACGAAGAAGAAGACTGAAGCCTAGGGCAAAAAAACCCTAGGATGAAGCA TCCATCTTGTATTCCCTATGGGGAGGGCATGGACTCCTGTAGAAAGGGAA TCGAACCTTATGAGACAGGACCAATCAAAATCCTAGATAAATTAGCATAA TGCTTCCCCTGTACCCCACTCTCGATTTACTCCATTGTAAGAACTAACGA TGGAGCATTCCTAACACGAAGAACACCACTATTAGACGTAGAACTTAGAG GCCTGAACCATGATATATCCCTTGTGTTTTTTACTGTTTTGAGTGCTCGA GGCCACCGATGGCACACGCATCGACCCAAGTCGAACAACCTAATGATTGT CGTGCTTAGGAACCCACGCGACAACTGTCCTTACGGATTTTTTTTCTCTT TTTGAGACCATATCATCACTGTTGAAAATGTCAATTACAGTACTTGCAAA ACCAGGAAAGTAGTAACTTTTAAGGGTCACTACTACAAAATTAGGTTTTC GAGATGACACCTTTTATTTTCAGATGCGATATAAAAGGGTCCGCCTCTAC TGTGTAGCCCTTTTTACATTTTCATATTCCTTGGTCACCAATGTGTCTAG TTTTCAATGTAAAACGTGACTTTTTTTTCTGAAATATAATACAACTGTGC AGCTTGGCATGGGGAGTGCCGTGGAAACCCTGTGCGGCCAAGCCTACGGC GCACACAGGTACGAAATGCTGGGCATCTACCTGCAGCGCTCGACCATCCT GCTCGTCGCCGTGGGCGTGCCGCTCAGTGTCATCTACGCCTTCTCCGAGC CCATCCTCGTCTTCCTCGGTGAGTCTCCGGAGATCGCCAAGGCCGCGGCC GTCTTCGTGTACGGCCTCATCCCGCAGGTCTTCGCGTACGCGGCCAACTT CCCCATCCAGAAGTTCCTGCAGGCGCAGAGCATCGTGGCGCCCAGCGCCT ACATCTCCGCGGCGACGCTGGCGCTGCACCTGCTGCTGGGGTGGCTGGTG GTGTACAGGCTCGGCATGGGCCTCCTGGGCGCGTCGCTCGTGCTGAGCCT GAGCTGGTGGATCATCGTCGCCGCACAGTTCCTGTACATTGTCACCAGCG AGCGGTGCCGGCGGACGTGGACGGGGCTCTCCTGCCGGGCGTTCTCGGGC CTGCTGGAGTTCCTCAAGCTGTCGACGGCGTCGGCTGTGATGCTGTGCCT TGAGACGTGGTACTTCCAGATCCTCATCCTCATCGCCGGCCTCCTCGACA ACCCTCAGCTCGCCCTCGATTCACTAACAGTCTGGTACATTTCCGACAGC ATATCGAAAGATACCGTCTGCAGTTTGCATGCATGCATGTATTACGTACT CAATCAATTGCTTTAATTTTGTTTTGTTGGACAGTATGACGCTTGCTGGA TGGGTGTTCATGATCTCCATTGGGTTCAATGCTGCTGCGAGGTGAATACT GAATCATAGTATCTGTTAATGTACATTTATATACACGTTCTACTTCTACC TGTTTCCATATATAACTACCACTACTGTCGTCTGCGTTTGCATCACTACT ACTACTAGTGTGAGAGTTGGGAATGAGCTCGGAGCCGGGCACCCGCGGGC AGCGGCGTTCTCTGTGGTGGTGGTGACCGCTCTGTCGTTCGTGATCACTC TGGCCATGGCGGTGGTGTTCCTCGTCTTCCGCGACTACCTCAGCTACATC TTCACGGAGGGGGAGACGGTCGCCCGCGCCGTCTCCGACCTCTGCCCTCT CCTCGCCACCACGCTCATCCTCAACGGCATCCAGCCCGTCCTCTGCTCTG CGTCTAAAATAAACTCGTTTTGTCGTCTATGGTCACCAGGTGTAGCTGTC GGCTGTGGCTGGCAGAAACTCGTCGCGTATATAAACGTCGGTTGCTACTA CTTCGTGGGCATCCCTCTCGGCATTCTTCTCGGCTTCAAATTCCATCTTG GAGCAAAGGTATACTTCAGTTTCTAGTGACTAACCATATACATATGCTCA TATTGCAGTATGATGCAGAGCAAATTTACTTGCTCCGATCCTTGCAGGGA ATATGGACTGGGATGCTCGGTGGCACATGCATGCAGACGCTTATCTTGTT CTGGATCACTTTTAGGACAAATTGGAACAAAGAGGTTTGTATGTACAGTA CATATATAGGCGCCAATAAACGGATCGGAGACCATACTAATTATCTTTGC TGTGACTCAAGAAGATAAATTATTCCGATGGCTAAAGGGGAGCATTCCAC ACAGTATGAGGGTGCACATATGCAAAATTAATCTAAAATTAGGCTTAAAG TATTTTTTTTGAAGAGCAAATCATGTTTTGATACCATAATATATTTTTAA GCCTAAAATTCGAGAAATAAGGATAGCATATGGGCCTCAAAATGGTCCAA AACATAACCTAGCGATGGCAGTGCAGAGATACCGATGAACAATAGAACTG AGTATGAGGGAATTAGATAGGCATCTTATAGGTTTTTGTGTTCTTCATGT CTTACGTGTTTTTGTGCAGGGTTTTTTTTTTACAACAGTTTTTGTGCAGG TTGAGGAAGTCAGGAAGAGACTGAACCAATGTGAGGACAATAAGCAGCCT CTTCTGCTAGTTCCCTCGGATTAACTCACGAGAATCAATTGCTTGTGGTT GTTGGATTTTTTTTATGTATGGCTTTCAATATTTATTATTACAATTATTT ATCACCTCTATGTGTGGAAATACTATTGATATATTTGGTTGATAGTTAAT AATGAACTCGAGGAATTTGTAGTCGAGGTGCCAAGGACATTTGTGCTGGA ATACAGTATTGAGGAATAATT
back to top