Sh_002I17_g000070

Overview
NameSh_002I17_g000070
Unique NameSh_002I17_g000070
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length189
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_002I17contigSh_002I17:40333..40521
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NoteConserved hypothetical protein
TypemRNA
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_002I17_t000070Sh_002I17_t000070R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_002I17_g000070 ID=Sh_002I17_g000070|Name=Sh_002I17_g000070|organism=R570 Sugarcane cultivar|type=gene|length=189bp
ATGACCGGAAAGACCACGAGGAACAGGGGGGCGGGGATTGACTGCACAAG
AAGTGTGAGTAGGGAGCAGAGAGCCATAAACAGAAGGAACAAACTTGAGT
CATCACTGGTTTTAAGGCGGAGTTATGTCCCTAGTGGTAACAAGAGAGCC
TTGAACCGTGCCATAAAATGGATGCTAGAACGTGAGTAG
back to top

gene from alignment at Sh_002I17:40333..40521-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_002I17_g000070 ID=Sh_002I17_g000070|Name=Sh_002I17_g000070|organism=R570 Sugarcane cultivar|type=gene|length=189bp|location=Sequence derived from alignment at Sh_002I17:40333..40521- (R570 Sugarcane cultivar)
ATGACCGGAAAGACCACGAGGAACAGGGGGGCGGGGATTGACTGCACAAG AAGTGTGAGTAGGGAGCAGAGAGCCATAAACAGAAGGAACAAACTTGAGT CATCACTGGTTTTAAGGCGGAGTTATGTCCCTAGTGGTAACAAGAGAGCC TTGAACCGTGCCATAAAATGGATGCTAGAACGTGAGTAG
back to top