Sh_002I17_g000100

Overview
NameSh_002I17_g000100
Unique NameSh_002I17_g000100
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length497
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_002I17contigSh_002I17:67859..68355
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NoteConserved hypothetical protein
TypemRNA
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_002I17_t000100Sh_002I17_t000100R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_002I17_g000100 ID=Sh_002I17_g000100|Name=Sh_002I17_g000100|organism=R570 Sugarcane cultivar|type=gene|length=497bp
ATGGATAATAACGTTGGATCAAGCACTGCTAAGAATTTTTATGTTCGACC
TTTAAAGAAAGCAAAATGTACTGAATTTGATATGTTGGAATCGGATAAAA
TGAAAAATGTTCATCCAATGCCTTCAACTGCATCACCAACCAGAGAGACA
TTATCTTCAGTTTGTGAATTCAAAGATAAGCAGATAAGTCATGAAAAACA
TTCAGGTGAACTTATTATTGTTGATCCAACCATGAGGTTTTTTTTCATTT
ATATCTGTTCTTTGGTATGTAATCTTTTGATTATAGTACTGAGGATATAA
AGCTAATCCATATTAAATTATATGCAAATTATACATTGACCAATATGGAC
TTATGTGCCCAAATAATAATAGAAACATCTTCGAAAGACGATCTACTGGT
GAAGATGGATGAAATATCTATGAAACAACATCAATTGTTGTGCCTCCTAG
ACCAAAGCAAATGGTTAGATGATGATGTAAGTACACCTAATGATTAG
back to top

gene from alignment at Sh_002I17:67859..68355+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_002I17_g000100 ID=Sh_002I17_g000100|Name=Sh_002I17_g000100|organism=R570 Sugarcane cultivar|type=gene|length=497bp|location=Sequence derived from alignment at Sh_002I17:67859..68355+ (R570 Sugarcane cultivar)
ATGGATAATAACGTTGGATCAAGCACTGCTAAGAATTTTTATGTTCGACC TTTAAAGAAAGCAAAATGTACTGAATTTGATATGTTGGAATCGGATAAAA TGAAAAATGTTCATCCAATGCCTTCAACTGCATCACCAACCAGAGAGACA TTATCTTCAGTTTGTGAATTCAAAGATAAGCAGATAAGTCATGAAAAACA TTCAGGTGAACTTATTATTGTTGATCCAACCATGAGGTTTTTTTTCATTT ATATCTGTTCTTTGGTATGTAATCTTTTGATTATAGTACTGAGGATATAA AGCTAATCCATATTAAATTATATGCAAATTATACATTGACCAATATGGAC TTATGTGCCCAAATAATAATAGAAACATCTTCGAAAGACGATCTACTGGT GAAGATGGATGAAATATCTATGAAACAACATCAATTGTTGTGCCTCCTAG ACCAAAGCAAATGGTTAGATGATGATGTAAGTACACCTAATGATTAG
back to top