Sh_002I19_g000040

Overview
NameSh_002I19_g000040
Unique NameSh_002I19_g000040
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length3355
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_002I19contigSh_002I19:37400..40754
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NoteConserved hypothetical protein
TypemRNA
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_002I19_t000040Sh_002I19_t000040R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_002I19_g000040 ID=Sh_002I19_g000040|Name=Sh_002I19_g000040|organism=R570 Sugarcane cultivar|type=gene|length=3355bp
ATGAACATTAGTCGACGTGGAGTGCGACTGGACACAAGATGCCCTGTATG
CTTCCGCTTTGATGAGGATGGTGGCCACTGTTTTCTCAAATGCAAAATGA
TTAGACGCTGCTGGGCTGCTCTCTCCCTTGAACCGATTCGTCAAATGCTC
TTATTAAAACGATCGGCTTGGGAGGTGATAGTTACTGTACTTGGCTTGAA
GGAGGATGTCTGCATCAAGACGATGCTCCTACTCTGGCGCTGGTGGAGTG
TGCGAAATAAGGTGAACCAAGGAGAGAAGGGGCTGTCTGCGGATGAAGTA
GCTGCTGATGTTCTGAAGCTGATCAGTGATATGGGGTCTACCGAAAGACA
GCAGCCGATCCATCGTGAGGCTGCCGTGAAGAAATGGAACGCCCCACCGC
AGGGACAGCTTAAAATCAATACTGATGGCTCCTTCATTCCGGAGATGCTC
CAAGGCTGCTGGGGCTTCATTGTACGTGATCATGAAGGTGGTGCAGTCCT
GGCCGGGGCTGGACGGTTGGGTGCGGCACCAGATGCACTCAGTACCGAGG
CTACAGCTTGCCAACAAGCTCTCCAAGCGGCCACTGATTATCGTATATCA
CGCATTCAGGTTGAGGTTGATTCGTCTGTTCTGCAGCATGCTCTACAATC
TTCCACTATGGATTTGGCGACCTGTGAGATGATGATCAAGGATACTCGTT
TCATGTTACAAGAGCATTTCGTATGTAGTGGCATTATTTCCATCCCAAGA
TCTTGTAACTCTGTCGCACATGACTTAGCAAAGCTTGCTATGAGTTGGGA
CCCAGGTAACCTATATGTTTGGGCACACCGCCTCCCATAATTTGTAAATA
CTCTAGTCGCTCGCGATTTAGTCGAGCCAATGTTTCCAATGGAAAGGCCA
TAGAGCCTACCTTTGTTTCAAAAAAAAAAACAATGCCCGTCTGTGAATCT
CACTTCTGTATAAAGATCATTTATAATTTGGACCCTACGGTGTTGTAAAT
TTATCAAGCCTTTGTACTTTGTAACTTCTTTCCAGTCCGTGGATGCAACG
ACCTAAGTGGATATGAATTAGAAAATATTTAAAGCGAAGTTTGGAAGAAT
CAGTAGCTCAAGTATGCAAATACCATGCATTGAAATATTTTAATTACGTC
AGGCCGCTCCCTCCTCTAATCCCTCCGCTCACCAGGCTCCGCCGTCGCCG
GTCACAAAAGGACGCCCGCGCCTCTCACCATCGGCGCGACGCCATCCAGC
TCCGCAGGTCGCCAATCACGGTCGCCGCGGCTCCATCCACGTCTGCACCA
TTCCTCAGTCGTCTTCTTCATCCCAATCGTTCGAATCTGGTGTCTTCGTC
TCCTCTGGGTGGCCGACGTGCATGCTGCCAGTGAACGGAGACCGTGACTC
TCACCTAAACGACCTGCAGGTTAGCGGCCCTTCTCCCTATCCCTTCTGAC
ATGAGTTCGATTTGGATTCACTCCTTGGTTCGTCTTCCACCACCCCCCCA
CCCCCAAATCCTCCATGGATGCTCTTGTGCGGAGAGGAGCGACAGTCGTC
CCGGCGCAGGGTCGGATCTCGCGGAGCGGCGGCCGGCCAGCCTGGGGGCG
GAGCTCGTTGTGCAGACACGGCGGCCAGACCGCCGAGGCGCACCGCGCGT
GGAGCGGAAAGGCAGCCGGCCCACCGGGGGTGGACCTCGCGGAGAGGAGC
CGGCCTGCCGGGGGCGGCGTGAAGCGGCGGCCGTCCCTGCCGGGGGCTTC
TTCGTCAAGTTCATTTGGATTCGCTCCTTGTCCATATGTGCAGATCCGTC
AAGCGACTCGGCCTCCCATGTCAATCAGCAGTCGGTGCATCCAACTACAC
GAGGAACTTGAGAGAGTGGCATCACCGGCCACGCAGCGGAGGCTCGATCC
GGTAGGAGCTCCTCCAGGCATGTTTCACGTTCAGTGCCGGAGGCTCCCAC
ACGAGTGGTGGAAAAGGAAATAACCGAAGCAAAGTTTTACCCTCGTAGAA
ATCCCTCGTAGAAATTCTGGAATAAATATTTGTGGATTCTGTGATGATCC
ACTGATCTGCAACTGAACACTATTGCCAATGCTATCGAGAAATGAAATTG
ATCTGGTCGATCACGTGAGTATTTTCAATCTTATTTTATCCGTTGATTTT
TACTACTGTACGGTGTAGGATGATCAACCTGCTGCATGATGGTTGGACCA
GGCAGCGGAGTAGAGGGTATTTCTTTTATGATTGACCGGTGGAAACCTGC
TCGTATGCTCATGTAGCAACATCGAAGGGATTTTAACATGCTCATTTGCT
CAGGTAGCAAGACTGGCGGGAATGGTTGCAATGGGCCTTAGTTTCTCTGT
CCGTCAATCAGGTATCTCCTATGCATTGTTCTTCACTTTTATATTCTTGG
TTCTGAATGTAAGTTCAGTTCTAATTCATAATTAGAATGTGTGTATTTAC
CTAGACAAAAGGATGAATAATTGGCATCAGTTTGCGCTTGCTGTGATGCA
GAATCTACATTATGTGCTCCTAGAATAAATGATCAGGGCGATTTCAGATT
TGCAATCTAGTGCATCCAGTGTGCCTAATATGGTTTTGGCGGCATGGACA
TGGACGCAATAGAGGATGCAGTGGCGTTTCTGAGCTGCTGTCTCTGGTGC
GTTTGGCCACTCATATGTACTGTTGCTGTCTTTGGGTGACTATTTTGAGT
ATTTGTACCAGCAAATGCATTCCATGGCATTGGCATATATGCCTGAACCG
GCTTTTGGACGTCTGAGTTTGCTGTTGCATATATGTGTGTGTACTTGTGT
ATTTTAGCTCAAAGTTTTACTTCTACATATATTTTAGCCGTAATTATATT
ATGCAATTTTATTCCTGGTGACTTTTTCTGAAAAGTACATACTATTCCAA
AAAATGGATGAAGCATAATTCTTTCTTGTGCGCACACATCTGAATCTCGA
ATTCATTTCCGTAAAATTTCCTCTGTGCCTTTCTCCTCTGTTTCTACTAA
CTAGTTTCTTTATTGATGATTTGCATTTTCCGTATACAGAGCCACTTGGG
TTAGAGTTGTTGATTGCCAGAGCATCAGATCAAATGGATATTCTAAATGG
AAATGTTCTGAACTCAGTTGACAATAATTTAGGCCATAATGATGGTTTTA
GTACTCTCAGGAGAACAGAGGCATAGTCATGGTTATTTCAAAGAAATGTG
TGGTCATCTTGTATCGTTTGTGTTCAATAGTTCATGTAATATTGATGTAG
TACCATCATTTTTTGTTATAATTCGACGATTTTATGTTGTAATATACAAG
CACAAGTTTGATAGTGAGATGCTTGGTTTACTTATCGTAGTTACGCACAG
TTTCA
back to top

gene from alignment at Sh_002I19:37400..40754+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_002I19_g000040 ID=Sh_002I19_g000040|Name=Sh_002I19_g000040|organism=R570 Sugarcane cultivar|type=gene|length=3355bp|location=Sequence derived from alignment at Sh_002I19:37400..40754+ (R570 Sugarcane cultivar)
ATGAACATTAGTCGACGTGGAGTGCGACTGGACACAAGATGCCCTGTATG CTTCCGCTTTGATGAGGATGGTGGCCACTGTTTTCTCAAATGCAAAATGA TTAGACGCTGCTGGGCTGCTCTCTCCCTTGAACCGATTCGTCAAATGCTC TTATTAAAACGATCGGCTTGGGAGGTGATAGTTACTGTACTTGGCTTGAA GGAGGATGTCTGCATCAAGACGATGCTCCTACTCTGGCGCTGGTGGAGTG TGCGAAATAAGGTGAACCAAGGAGAGAAGGGGCTGTCTGCGGATGAAGTA GCTGCTGATGTTCTGAAGCTGATCAGTGATATGGGGTCTACCGAAAGACA GCAGCCGATCCATCGTGAGGCTGCCGTGAAGAAATGGAACGCCCCACCGC AGGGACAGCTTAAAATCAATACTGATGGCTCCTTCATTCCGGAGATGCTC CAAGGCTGCTGGGGCTTCATTGTACGTGATCATGAAGGTGGTGCAGTCCT GGCCGGGGCTGGACGGTTGGGTGCGGCACCAGATGCACTCAGTACCGAGG CTACAGCTTGCCAACAAGCTCTCCAAGCGGCCACTGATTATCGTATATCA CGCATTCAGGTTGAGGTTGATTCGTCTGTTCTGCAGCATGCTCTACAATC TTCCACTATGGATTTGGCGACCTGTGAGATGATGATCAAGGATACTCGTT TCATGTTACAAGAGCATTTCGTATGTAGTGGCATTATTTCCATCCCAAGA TCTTGTAACTCTGTCGCACATGACTTAGCAAAGCTTGCTATGAGTTGGGA CCCAGGTAACCTATATGTTTGGGCACACCGCCTCCCATAATTTGTAAATA CTCTAGTCGCTCGCGATTTAGTCGAGCCAATGTTTCCAATGGAAAGGCCA TAGAGCCTACCTTTGTTTCAAAAAAAAAAACAATGCCCGTCTGTGAATCT CACTTCTGTATAAAGATCATTTATAATTTGGACCCTACGGTGTTGTAAAT TTATCAAGCCTTTGTACTTTGTAACTTCTTTCCAGTCCGTGGATGCAACG ACCTAAGTGGATATGAATTAGAAAATATTTAAAGCGAAGTTTGGAAGAAT CAGTAGCTCAAGTATGCAAATACCATGCATTGAAATATTTTAATTACGTC AGGCCGCTCCCTCCTCTAATCCCTCCGCTCACCAGGCTCCGCCGTCGCCG GTCACAAAAGGACGCCCGCGCCTCTCACCATCGGCGCGACGCCATCCAGC TCCGCAGGTCGCCAATCACGGTCGCCGCGGCTCCATCCACGTCTGCACCA TTCCTCAGTCGTCTTCTTCATCCCAATCGTTCGAATCTGGTGTCTTCGTC TCCTCTGGGTGGCCGACGTGCATGCTGCCAGTGAACGGAGACCGTGACTC TCACCTAAACGACCTGCAGGTTAGCGGCCCTTCTCCCTATCCCTTCTGAC ATGAGTTCGATTTGGATTCACTCCTTGGTTCGTCTTCCACCACCCCCCCA CCCCCAAATCCTCCATGGATGCTCTTGTGCGGAGAGGAGCGACAGTCGTC CCGGCGCAGGGTCGGATCTCGCGGAGCGGCGGCCGGCCAGCCTGGGGGCG GAGCTCGTTGTGCAGACACGGCGGCCAGACCGCCGAGGCGCACCGCGCGT GGAGCGGAAAGGCAGCCGGCCCACCGGGGGTGGACCTCGCGGAGAGGAGC CGGCCTGCCGGGGGCGGCGTGAAGCGGCGGCCGTCCCTGCCGGGGGCTTC TTCGTCAAGTTCATTTGGATTCGCTCCTTGTCCATATGTGCAGATCCGTC AAGCGACTCGGCCTCCCATGTCAATCAGCAGTCGGTGCATCCAACTACAC GAGGAACTTGAGAGAGTGGCATCACCGGCCACGCAGCGGAGGCTCGATCC GGTAGGAGCTCCTCCAGGCATGTTTCACGTTCAGTGCCGGAGGCTCCCAC ACGAGTGGTGGAAAAGGAAATAACCGAAGCAAAGTTTTACCCTCGTAGAA ATCCCTCGTAGAAATTCTGGAATAAATATTTGTGGATTCTGTGATGATCC ACTGATCTGCAACTGAACACTATTGCCAATGCTATCGAGAAATGAAATTG ATCTGGTCGATCACGTGAGTATTTTCAATCTTATTTTATCCGTTGATTTT TACTACTGTACGGTGTAGGATGATCAACCTGCTGCATGATGGTTGGACCA GGCAGCGGAGTAGAGGGTATTTCTTTTATGATTGACCGGTGGAAACCTGC TCGTATGCTCATGTAGCAACATCGAAGGGATTTTAACATGCTCATTTGCT CAGGTAGCAAGACTGGCGGGAATGGTTGCAATGGGCCTTAGTTTCTCTGT CCGTCAATCAGGTATCTCCTATGCATTGTTCTTCACTTTTATATTCTTGG TTCTGAATGTAAGTTCAGTTCTAATTCATAATTAGAATGTGTGTATTTAC CTAGACAAAAGGATGAATAATTGGCATCAGTTTGCGCTTGCTGTGATGCA GAATCTACATTATGTGCTCCTAGAATAAATGATCAGGGCGATTTCAGATT TGCAATCTAGTGCATCCAGTGTGCCTAATATGGTTTTGGCGGCATGGACA TGGACGCAATAGAGGATGCAGTGGCGTTTCTGAGCTGCTGTCTCTGGTGC GTTTGGCCACTCATATGTACTGTTGCTGTCTTTGGGTGACTATTTTGAGT ATTTGTACCAGCAAATGCATTCCATGGCATTGGCATATATGCCTGAACCG GCTTTTGGACGTCTGAGTTTGCTGTTGCATATATGTGTGTGTACTTGTGT ATTTTAGCTCAAAGTTTTACTTCTACATATATTTTAGCCGTAATTATATT ATGCAATTTTATTCCTGGTGACTTTTTCTGAAAAGTACATACTATTCCAA AAAATGGATGAAGCATAATTCTTTCTTGTGCGCACACATCTGAATCTCGA ATTCATTTCCGTAAAATTTCCTCTGTGCCTTTCTCCTCTGTTTCTACTAA CTAGTTTCTTTATTGATGATTTGCATTTTCCGTATACAGAGCCACTTGGG TTAGAGTTGTTGATTGCCAGAGCATCAGATCAAATGGATATTCTAAATGG AAATGTTCTGAACTCAGTTGACAATAATTTAGGCCATAATGATGGTTTTA GTACTCTCAGGAGAACAGAGGCATAGTCATGGTTATTTCAAAGAAATGTG TGGTCATCTTGTATCGTTTGTGTTCAATAGTTCATGTAATATTGATGTAG TACCATCATTTTTTGTTATAATTCGACGATTTTATGTTGTAATATACAAG CACAAGTTTGATAGTGAGATGCTTGGTTTACTTATCGTAGTTACGCACAG TTTCA
back to top