Sh_004G10_g000050

Overview
NameSh_004G10_g000050
Unique NameSh_004G10_g000050
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length312
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_004G10contigSh_004G10:14758..15069
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NoteKinase
TypemRNA
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_004G10_t000050Sh_004G10_t000050R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_004G10_g000050 ID=Sh_004G10_g000050|Name=Sh_004G10_g000050|organism=R570 Sugarcane cultivar|type=gene|length=312bp
ATGTTCACCGGGAGGAGCCCTACTGACGACATGTTCAAAGACTCGTTGGA
TCTTCATAGGTTCGCCGAAGCCACTCTCCCCAACGGAGCCTCCGAGATAG
CCGATCCAGCAATCTGGCTGCATGAAGAAGCGAAGGCAAAATATCCTGCT
GATGCTGCGACAATGAGAAGCCGGAGCGAGGAGTGCTTGGTTTCAGTGAT
CCTGCTCGGCGTCTCATGCTCAAAGCAGCAGCCAAGAGAGCGAATGGCGA
TGCGAGATGCTGCTATGGAGATGTGTGCGATCAGAGACGCGTACCTCATG
GTTGACAGCTAG
back to top

gene from alignment at Sh_004G10:14758..15069+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_004G10_g000050 ID=Sh_004G10_g000050|Name=Sh_004G10_g000050|organism=R570 Sugarcane cultivar|type=gene|length=312bp|location=Sequence derived from alignment at Sh_004G10:14758..15069+ (R570 Sugarcane cultivar)
ATGTTCACCGGGAGGAGCCCTACTGACGACATGTTCAAAGACTCGTTGGA TCTTCATAGGTTCGCCGAAGCCACTCTCCCCAACGGAGCCTCCGAGATAG CCGATCCAGCAATCTGGCTGCATGAAGAAGCGAAGGCAAAATATCCTGCT GATGCTGCGACAATGAGAAGCCGGAGCGAGGAGTGCTTGGTTTCAGTGAT CCTGCTCGGCGTCTCATGCTCAAAGCAGCAGCCAAGAGAGCGAATGGCGA TGCGAGATGCTGCTATGGAGATGTGTGCGATCAGAGACGCGTACCTCATG GTTGACAGCTAG
back to top