Sh_004L14_contig-1_g000010

Overview
NameSh_004L14_contig-1_g000010
Unique NameSh_004L14_contig-1_g000010
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length375
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_004L14_contig-1contigSh_004L14_contig-1:5256..5630
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NoteSKP1-like protein 1B
TypemRNA
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_004L14_contig-1_t000010Sh_004L14_contig-1_t000010R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_004L14_contig-1_g000010 ID=Sh_004L14_contig-1_g000010|Name=Sh_004L14_contig-1_g000010|organism=R570 Sugarcane cultivar|type=gene|length=375bp
ATGACTGCGCCGACAACGGCATCCCGCTCCCCAACGTCAACTCCAAGATT
CTCGCCAAGGTCATCGAGTACTGCAACAAGCACGTCCACAGCACCGCCGT
GGACACACACCACCAATGCCTCCGGGGGCGGCGAGGACCTCAAGAGCTGG
GACGCGGAGTTCGTCAAGGTCGACCAGGCTACGCTCTTCGACCTCATCCT
GGCTGCCAACTATCTTAACATCAAGGGATTGCTGGACCTGACCTGCCAGA
CGGTGGCTGACATGATGAAGGGCAAGACTCCCGAGGAAATCCGCGAGATA
TTCAACATCAAGAACGACTTCACCAAAGAGGAGGAGGATGAGATCCGCAG
GGAGAACCAGTGGGCCTTCGAGTGA
back to top

gene from alignment at Sh_004L14_contig-1:5256..5630+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_004L14_contig-1_g000010 ID=Sh_004L14_contig-1_g000010|Name=Sh_004L14_contig-1_g000010|organism=R570 Sugarcane cultivar|type=gene|length=375bp|location=Sequence derived from alignment at Sh_004L14_contig-1:5256..5630+ (R570 Sugarcane cultivar)
ATGACTGCGCCGACAACGGCATCCCGCTCCCCAACGTCAACTCCAAGATT CTCGCCAAGGTCATCGAGTACTGCAACAAGCACGTCCACAGCACCGCCGT GGACACACACCACCAATGCCTCCGGGGGCGGCGAGGACCTCAAGAGCTGG GACGCGGAGTTCGTCAAGGTCGACCAGGCTACGCTCTTCGACCTCATCCT GGCTGCCAACTATCTTAACATCAAGGGATTGCTGGACCTGACCTGCCAGA CGGTGGCTGACATGATGAAGGGCAAGACTCCCGAGGAAATCCGCGAGATA TTCAACATCAAGAACGACTTCACCAAAGAGGAGGAGGATGAGATCCGCAG GGAGAACCAGTGGGCCTTCGAGTGA
back to top