Sh_004L21_g000030

Overview
NameSh_004L21_g000030
Unique NameSh_004L21_g000030
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length7487
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_004L21contigSh_004L21:18370..25856
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
Notesimilar to H0523F07.13 protein
TypemRNA
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_004L21_t000030Sh_004L21_t000030R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_004L21_g000030 ID=Sh_004L21_g000030|Name=Sh_004L21_g000030|organism=R570 Sugarcane cultivar|type=gene|length=7487bp
GCGGCGTCGGCGGCGGCGCCTTCATGCTCGTCAGGCTCGCCGACGGCACC
GCCGTCGTGTACGACTCCCGCGAGACCGCGCCCCTCGCCGCCTCCAAGGT
GAGTCAAGCACTCAAGCTAGCTAATGCCGCGTATCGCGCGCGGTCGTCAA
ATTAAGCATTATTGTCGACTTGTGGTACTAGCAGGAATTTGCGAGTGCTT
TGCCCCTTGGATTCTTCTTTTCTGGTCTTTGTCACATAGCAGTTCATCGA
TCGATGACAAAGGTTGTTAGATATATAGTACAGTACTAGCTCCCGATTGA
CTAGGACTCAAGCACGGCGGAGATCGAGATTAGATCACAAGAAAATTTAT
TTGTGAAAGGATACTGCAAAGCCGGATGGAGTATAAAGTAATCATGCCAA
ATATAATACGACTTGCCAGTAGAGTAGGTGGTTGATTCACATGGTTGTTG
CTTAAGCAAATTGTCTTTCAAATTAAAACAGGATATTATTGTAGTAACTT
ACAAAGTGCCGGTATTGGTGATAACTGATAAGACTGTGGTAAGGCATTGT
CTTCGCCGTAGTAGTCATGACAGTGCTATTGCCTGTGTGAGGATGTGCCT
TGGAGTGGTGGGAAGAACAAGAGGAGTCAGAAATACAATTGTTTACAGGA
CCAGCAGTATAAATTTCTTTAAAATTTAGTCGAAGTTAAAAAAAATCAAT
AGAAACTGTAGAGATTCAGGGGGTGTTGCCCCCCTATCTCTGCCACTAGG
AAGAAGAACCATGAGCGGCGGATTTATCCATGTTAGCTACTTAGGTAGCT
ACACTAAGCAAGTAAGATCAATCAAAGAATAAAACGTCCGTGTCGTTGTT
CTCCTCTCTTGCCGTGTGGAAAGTGCTTCACGCGCGCTTTCGTCCACTTC
TCGGTGTCCCCTACAGTGTCGCTGCACTGTAGTGTCTGCACACTGGACCG
CCGGTGAGCAACGAGAATTGGGAAAGCCGAAAGCCAAAAGGAATCCAAGT
CATATAGGGTTGATGTTTACAGTACAACAATCGTGCCAAGATCACAACCA
GCACTCCTTTCATCACTCCATCCATATGCACTAGTGCACAAGCACAAAAA
ACCGCGTGTTGTTGGGGGCATGTTTGGGACTCACATTCTATCATAGCACC
ATGCATACCAGAGGCTTCCTTCCCTGAAGTTATTTTTTTTAGCTCAAACA
AGTATATTTTTCACATCTTTCCGAGGAACAATGTATTTAGAAAAACTAAA
ACGTCTTATAATTCAGAACGGATGGAGTAGTACCGAACCCACGTGATACT
GAGTTTGAGCCTTGAGATGAGTACAGTCGCAGCTTAATCAAAGAATAAGA
CATGCATAAAGTTTGCTATGCGTATTCCAAATTATAGTTTACTTTAACTT
TAGTCAAACTTGTCTAGCTTTGACCAAGTGTATAGAAAAATGTATCAACA
TCAACATCATCAAATTAGTTTCATTACATTGTTTTCATAAAATTCTTGAT
AGTACATTTATTTAACACTTCTTCTATAATTTAGGTGCCTGAATTTTAAG
ATAATTTCAGGCAACACTCTTGTACTACCAATTAGTACAAGTAAATTGTC
ACTTTTGTGATTTGTTATCTGTCTTTGTGCCATAACATATTAAACTTTTG
TCCTTATCTGACTATAAAAATAATTGTAATTTGTTAAATTATCTTTGTGC
CAACATATATCAGATTTTGTCAGGTTTGTGGTTTTGTCTAACGGGTTTTT
TACTCTCGGAACAAAAAATTGCAGATTGTGTCTACAGAAATTGCAACGAA
CTAAAACTGCAATTTTAGTATAAAATATCTGCAATAACCATCGCCTGAAA
GAAATCTAAAATTCAGGCACCTGAAATTTAGCAAATCCCTTTATTTAAAC
TTGGAGATGTTGATATTTTTTTCTAAAAAAAATTAGTCAAAGCAGGAAAG
TTTTAATTAGGACAAGACTAATGTAAGCTCTAATTTAAAATTGAATGATA
ATAATAAGGCACCTAAAGAAAAATGAGAGAAGGCTAATCATAGTGATCTG
TCAAGAATATTTGCCAACGTCACGTTAGAATCATAGTGCACATGCCATGT
TTTTAGCTCTATGCCTGCCCCTCTTATTTATAATTCAAATTAAGTCAAAT
GATTTCTGTACAAACAATGAGTGGATTTAAAATATCTCGTTTCCTTTTAT
TCTAAAGTTTCAAATGCGGACAAAGAGAGATTGTTTTCTATTTATGACCA
TATTACCTCGCAGGAGGAGGTAATAGGTCACATCGACCTTTTATACCACG
GGGATGGTTCAAAACTCTTTTGGGAGTACCGTTAAAAACATGTATCTGTT
TCTCTAAGTACCTTCTATAATCATATAGTCATAGGTGTCTGGAAATCCCC
ATAAATAGCGACACAAAGGTGGTCGGTGGATGGGGGTTAGGGCTTTGGGG
TGTCTAATAAAATGGGATTTGGTCTTGCTTTTGGGACGAAGTTGAGCCAG
GGAAAGCAGTGCGTGGGACGGCAAGGAAGAACGCTACAAATAGTTGGGAG
GAGGTGGGATGACCTGGCAACATGACATGAGCACATGACAGGGCAAAACG
CGATTGGCTGGCAAGGGAGGAGTGTGCTATAGAGCGTCCGCAGTGGGTGC
TCGTAGCTCGCTCCAATACAATAAAGGCAAGATCCCATTTCAAAAAAAAA
AGCAAGATCGAACCGACTATCACTGTGAACCCTTTCCATGGAGAAGCCGG
TCCCTTCCATAGAACCTGGCTCCATAAAAAAAAAGAAATCGCACTCTCTC
TTTCACCCTTCTTCTCTTTCCTACCGTTGATGCTCCCGCCGAAGGGAGGA
ACTCGTCCTCCTCCTCCAGTCCTCTTCCTCCATGGATGCCGGCCCCGTCC
TTGCACCCCGCCACTCATAGATCTGGCGCTGAAGGACCGCTGGGGGTGGC
GGGTTCCGGGCGATGGGATCTGGGCGACAGGCTCGGGGTTAGGGCGTGTG
AGAAAGGAGGAGGCGCGGAAGCGCCATACCAGCTGAACGAGGAGAGAGAG
GAGGAGGCAAAGGAAGTTGCGCTAGCCGCTTGACGAGGGAGGAGGAAGAA
GTCCGTGCGGTTCGTGAGATGCGTGGACGGAGAAAACAAGTAACCGCCTG
ACGGGAGATAGATGAGGAAAGACGACGGTGTTGAGGAAAGGTATAGCGTG
TGCGCGCTTGAGATTATCAGCCAGATCAGCCAGTCATTCAGCAGTATTTT
TCTTAAAAAAATCAGCCAGAACAAGCGAACAGGCTGGTAGTTGGGCTTTA
ATGTTGTGGGTCCTACGTGTGGAGTCATCCCCGGTTCTATACATTATTGG
TAGCGTTAAACAGATGACGTCTAATCAATCGTGAGACCCAACTAAGACCC
AGGTGGGTTCTATACGCTCGACGGGATGACCATGACAATGATAGGGGATT
GACCAACGATGTAAGTATGGATATGGATTAGAGCACAAAGAGAGAGTTTG
ACTCCTAGACAAGGGGGGAAAGTAGAAAGTGATGGATAGAGACGCGACCA
GAAGGAAATGTCCAGGCATAGATCCTACGTGTTGCAAAATAAAGAATTTT
GAGTTCTATAAATCAAATCCAAGTTTTAAAAAAATTATATAATAGAATAT
TAATATATATGACACTAATTTACTTCGTTAGATATACGCACTCTCGAACG
AGCTAAAATATTAGAAGAAATAAACATTAGTTATTGTTACTAATGAAAAA
TCTACATTAAATTGTATATTTTTCTTCTTGTTTATTTCTTAACACAACCA
CCCCGCCTACTATAAATACAGGGCAAGCTCGCAAGCGTCGTCCTCGTCCT
CGCCCCCACCCCCACCCTCGCCTCCACCACCAGTGACCGGCAGCGAGCCG
CCTCGTCACGCCACCCACATCCACCCCACCTCTCGAACCCGCCCACACTA
ACCCCAGGGCAGCGTGCCGGCGAGCTCGCCGCGACGCCCCCGCAACGACC
TGGTCCGACCGTCTCCACCACCGCCAGGGCCCCAAACTGCCCCGCCGCCG
TCCCCATCGCTTGGCCGGACCCGCCGGTGACCTCCTCGCCTTCTTCCTCT
CTCGCGCGGGCGACGGCGCGCGCGAGGTGGAAGACGGTGCAGAAGGAGGT
GCGGCATGAGATGGAAGCATATAAATAAGGGTCAGGCTAGTGCCCGGACG
TCCGGCCCTGGGCCCTTGTCCGGACTTAGCTCCCCATGCCCCGCTTGTGC
TCTGCACCGCACGCCCCATCCACTCAGATTCCGCGCCGCTCGGACGACTC
GCCCCACCCACGCCGCCCCGCCCCCACGCGGGCCCACATCACCCGAACAT
CACTAGCATCGAGAAGAGGAGGTGACATCGAGGCGAGACAGCAGAAGATG
AGGAGAGAGATACAACACCCGATCTCTTTTGAAACATCCAAATGAAACAT
TTGCAACATACGTTCGAAAACAGTTGAAACACTTGCAACATAGGTCTGAA
ACACTTATAAAAACACCTGAAAACGCTTGAAAAGCTATTGCAAAATATAT
GCAACATACGTCTATATGCAACCCGATCTAAATATATGCAACATATGTGT
GAAACACGTGTAACATTTAGATAAACACACTTACAACATACGTCTGGAAA
AACAACTGAAACATTGGGAATAAAAACTTGCAACATATGTTAACAACCAT
TGCAACATATGCAACGTCCACGTGAAACACTTATAACATCCACATGAAAC
ATCTAAAATACCTGAAACATACTATTGCAACATGCGTTTTCAGTGCGCAA
TGTCACCTTGCTGCTTAGACGAATCACGAAGCTCGATGCCACCGCGACGC
ATAGTGCTCGCCAGTGCACCCCTGGGCGAGGACCTGCTCGGCTGCCTGGG
TGAGCACCTACGAGTGAGGTGCGCGAGCACCTGCTTCGCTTCCCGAGCCA
AGGCACCCTGGGCGCGGCAGAGGACGGGCATGGCGCGGCGGGGGATGGAG
GCGCTGCGGGGGATGGCGGCGGCGGTGCGTCGGAGTGTCCTGGCAGCGTC
GGCAGTCGAGTGCTGCGTCTCGGAGGTGGTCGCGCCAGGCGAGCGGATAG
AAACGAGTACGTGGATGAGCGGATTCTTTTTTTATTTAGAAACAGAGTAG
CGGGGGGCCGGCGTGTTCTACGGTGTCCAGTGGACTGACGTCCCCTTAAT
AGCATTAGCGTATAAATAAGTAATTACTTGGGCACGTCTTTCCCGGGGCC
GGGGGGGCAAAGGGCGGGCGCGGACTGCCACTAGTTTCAATTTTGAATTT
GAGTCGTGAGTGCTAAGCAGAGTAATGACGTTTAATAAGGAATTAGAAAC
GGCACTCGATCGGCTGCCCACTGCCCATTGTTCTCCCAACTTCCAAGGAC
GAGAGAATGAACACCAGAAACGTCAACCATGCATTCAGGACATGTACGGC
GGCAATGAGTCGCTGAAAGCACGGGGCGCGCTCTCCATAGCAGTTCCCGG
GGAGATCGCCGGCCTGTACGAGGCGTGGAAGCACCACGGCAAGCTCCCAT
GGAAGCGTCTCGTCCTGCCGGCCGCGCGGCTGGCCTTGGCGTTCAGGATC
TCGCCGTACCTGCGGATGCAGATGGAGGCGACCAGGGACGGCATCCTGGG
CAACAACGGGACGCGGGCCGTGTACGCGCCGGGCGGCGACATCCTCACGG
CCGGGGACGTGTGCCGCAACGCGAGGCTCGCCCAGACGCTGCGGGCCGTC
GCGGAGCGAGGGCCCGGCGTGTTCTACGGCGGCGCCGTGGGGGCGCGGCT
CGTGAGGGACGTCCGGGAGGCCGGAGGGATCCTGACGGTGGAGGACCTGA
AGAGGTACCAGGTGAAAGTGCGGCGGCCGCTGACGGGGAACGTGATGGGG
CTCCAGGTGGTGACCATGCCCCCGCCTTCCGCCGGCGGTGCCGGGATGAT
GCTTGTGAGTTCATTATCTGGTTCTCTGCATTCTGATCACCGATCAATTC
GTTCATGTTTAATTCCTTTGCTGATCTTGACTCACTTGTTCACTTATGGA
TAGGTCCTGAACATCCTTGATCAGTATGGCATTCCTGCTGGTTTCGCTGG
CTCTCTTGGGATTCATCGCCTCATCGAGTCCTTGAAACATTACATGGCCG
TAAAGATGAACCTTGGCGATCCTGACTTCGTCAATGATAGCGAGGTTGTG
TCTGATATGATTTCCCCCAAATTTGCTGCTGAACTGAAGAAAACCATTTA
TGACAACATGACATTTGCGCCTAAACATTACGGTGGAAGGTAAAGACTTT
CTGAATGCTATCGGTGATCGATGTTCATTACCTCACAGGTTCAGTTCCAC
GTCCCATTGCCATCTTTGCTGATCCTGATCAACTTGTGTTTTTTCAGGTG
GAACATCCTTCAGGACCATGGAACCAGCCACCTGTCCATCGTCGACAGCG
AGCGAAACGCAGTTTCGATGACGAGCACCGTCAACGCGTACTTCGGATCA
CTGATCCTTTCCCCACGCACGGGTATCCTGCTCAACAACGAGATGGATGA
CTTCTCCATGCCGGCGAACACGTCGGAGAATTCCCCACCGCCAGCACCTG
CCAATTTCGTCAGCCCTTTGAAACGGCCTCTCTCTTCCATGAATCCGACC
ATAGTTGTCAAGGTAAACTATATATATAGCGCGTAAAAGAAGCTGAGACG
ATCTGAAATGAGCTCATCAGACCATGTTTCTGATGATAGCTTGACTGTTT
TGTCATGTGCTGCATTTGCATAGGACGGGAAGCTGATGGCTGCAGTTGGT
GCCAGTGGTGGCAGCATGATCCCCGCTGGAACGATCGAGGTGTTCATCAA
CCATTTCGTCAAGAACATGGATCCATTGGCTTCTGTCATGGCGCCAAGGG
TGTATCACCAGGTTTGATACTTATATTTGGTGAAAAATAGCTTACTCCTG
TATTCCACGCACGGCGCTGATGCCGTCAGGTGTCACCCTGAGATTGAGAG
ACATGTCACCGACCGGCTAGATAATCTTTCTTCTGAGCTTGGTTTTGGTT
GCCATGTCCGCAGCTGATCCCAAACGAGGTCAAGTACGAGAACTGGACGA
CGGTGACCGGCGACCACTTCGAGCTCGACGCCGCGACGAGGGCCGACCTG
CAGAAGAGAGGCCACGTCCTGAAGCCGCTTGCCGGGGGAACCATAAGCCA
GCTCGTGGTGCACAACGTCGGGCGGCAAGGCGACCTGACCGCCGTCAGTG
ACCCCAGAAAAGGCGGTGTCCCGGCTGGCTACTGAGCAGGATCGAAGCAC
GGTTAATTAGTCCTCTGCTGATGTGTGTGTGATGTGTGACGGAGCCAGGA
AGAGAATATGGATAGCTCATCTCTTTAGGCTCTTGTGGTGGGACATGACA
AGGTTTTTTTTTACCGGTAGGAAAAAAATTTCAGTCCCTGGCGATAAATA
TGAAATTTCAGAAATTTCGGAAATATCGGGTCAAATT
back to top

gene from alignment at Sh_004L21:18370..25856-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_004L21_g000030 ID=Sh_004L21_g000030|Name=Sh_004L21_g000030|organism=R570 Sugarcane cultivar|type=gene|length=7487bp|location=Sequence derived from alignment at Sh_004L21:18370..25856- (R570 Sugarcane cultivar)
GCGGCGTCGGCGGCGGCGCCTTCATGCTCGTCAGGCTCGCCGACGGCACC GCCGTCGTGTACGACTCCCGCGAGACCGCGCCCCTCGCCGCCTCCAAGGT GAGTCAAGCACTCAAGCTAGCTAATGCCGCGTATCGCGCGCGGTCGTCAA ATTAAGCATTATTGTCGACTTGTGGTACTAGCAGGAATTTGCGAGTGCTT TGCCCCTTGGATTCTTCTTTTCTGGTCTTTGTCACATAGCAGTTCATCGA TCGATGACAAAGGTTGTTAGATATATAGTACAGTACTAGCTCCCGATTGA CTAGGACTCAAGCACGGCGGAGATCGAGATTAGATCACAAGAAAATTTAT TTGTGAAAGGATACTGCAAAGCCGGATGGAGTATAAAGTAATCATGCCAA ATATAATACGACTTGCCAGTAGAGTAGGTGGTTGATTCACATGGTTGTTG CTTAAGCAAATTGTCTTTCAAATTAAAACAGGATATTATTGTAGTAACTT ACAAAGTGCCGGTATTGGTGATAACTGATAAGACTGTGGTAAGGCATTGT CTTCGCCGTAGTAGTCATGACAGTGCTATTGCCTGTGTGAGGATGTGCCT TGGAGTGGTGGGAAGAACAAGAGGAGTCAGAAATACAATTGTTTACAGGA CCAGCAGTATAAATTTCTTTAAAATTTAGTCGAAGTTAAAAAAAATCAAT AGAAACTGTAGAGATTCAGGGGGTGTTGCCCCCCTATCTCTGCCACTAGG AAGAAGAACCATGAGCGGCGGATTTATCCATGTTAGCTACTTAGGTAGCT ACACTAAGCAAGTAAGATCAATCAAAGAATAAAACGTCCGTGTCGTTGTT CTCCTCTCTTGCCGTGTGGAAAGTGCTTCACGCGCGCTTTCGTCCACTTC TCGGTGTCCCCTACAGTGTCGCTGCACTGTAGTGTCTGCACACTGGACCG CCGGTGAGCAACGAGAATTGGGAAAGCCGAAAGCCAAAAGGAATCCAAGT CATATAGGGTTGATGTTTACAGTACAACAATCGTGCCAAGATCACAACCA GCACTCCTTTCATCACTCCATCCATATGCACTAGTGCACAAGCACAAAAA ACCGCGTGTTGTTGGGGGCATGTTTGGGACTCACATTCTATCATAGCACC ATGCATACCAGAGGCTTCCTTCCCTGAAGTTATTTTTTTTAGCTCAAACA AGTATATTTTTCACATCTTTCCGAGGAACAATGTATTTAGAAAAACTAAA ACGTCTTATAATTCAGAACGGATGGAGTAGTACCGAACCCACGTGATACT GAGTTTGAGCCTTGAGATGAGTACAGTCGCAGCTTAATCAAAGAATAAGA CATGCATAAAGTTTGCTATGCGTATTCCAAATTATAGTTTACTTTAACTT TAGTCAAACTTGTCTAGCTTTGACCAAGTGTATAGAAAAATGTATCAACA TCAACATCATCAAATTAGTTTCATTACATTGTTTTCATAAAATTCTTGAT AGTACATTTATTTAACACTTCTTCTATAATTTAGGTGCCTGAATTTTAAG ATAATTTCAGGCAACACTCTTGTACTACCAATTAGTACAAGTAAATTGTC ACTTTTGTGATTTGTTATCTGTCTTTGTGCCATAACATATTAAACTTTTG TCCTTATCTGACTATAAAAATAATTGTAATTTGTTAAATTATCTTTGTGC CAACATATATCAGATTTTGTCAGGTTTGTGGTTTTGTCTAACGGGTTTTT TACTCTCGGAACAAAAAATTGCAGATTGTGTCTACAGAAATTGCAACGAA CTAAAACTGCAATTTTAGTATAAAATATCTGCAATAACCATCGCCTGAAA GAAATCTAAAATTCAGGCACCTGAAATTTAGCAAATCCCTTTATTTAAAC TTGGAGATGTTGATATTTTTTTCTAAAAAAAATTAGTCAAAGCAGGAAAG TTTTAATTAGGACAAGACTAATGTAAGCTCTAATTTAAAATTGAATGATA ATAATAAGGCACCTAAAGAAAAATGAGAGAAGGCTAATCATAGTGATCTG TCAAGAATATTTGCCAACGTCACGTTAGAATCATAGTGCACATGCCATGT TTTTAGCTCTATGCCTGCCCCTCTTATTTATAATTCAAATTAAGTCAAAT GATTTCTGTACAAACAATGAGTGGATTTAAAATATCTCGTTTCCTTTTAT TCTAAAGTTTCAAATGCGGACAAAGAGAGATTGTTTTCTATTTATGACCA TATTACCTCGCAGGAGGAGGTAATAGGTCACATCGACCTTTTATACCACG GGGATGGTTCAAAACTCTTTTGGGAGTACCGTTAAAAACATGTATCTGTT TCTCTAAGTACCTTCTATAATCATATAGTCATAGGTGTCTGGAAATCCCC ATAAATAGCGACACAAAGGTGGTCGGTGGATGGGGGTTAGGGCTTTGGGG TGTCTAATAAAATGGGATTTGGTCTTGCTTTTGGGACGAAGTTGAGCCAG GGAAAGCAGTGCGTGGGACGGCAAGGAAGAACGCTACAAATAGTTGGGAG GAGGTGGGATGACCTGGCAACATGACATGAGCACATGACAGGGCAAAACG CGATTGGCTGGCAAGGGAGGAGTGTGCTATAGAGCGTCCGCAGTGGGTGC TCGTAGCTCGCTCCAATACAATAAAGGCAAGATCCCATTTCAAAAAAAAA AGCAAGATCGAACCGACTATCACTGTGAACCCTTTCCATGGAGAAGCCGG TCCCTTCCATAGAACCTGGCTCCATAAAAAAAAAGAAATCGCACTCTCTC TTTCACCCTTCTTCTCTTTCCTACCGTTGATGCTCCCGCCGAAGGGAGGA ACTCGTCCTCCTCCTCCAGTCCTCTTCCTCCATGGATGCCGGCCCCGTCC TTGCACCCCGCCACTCATAGATCTGGCGCTGAAGGACCGCTGGGGGTGGC GGGTTCCGGGCGATGGGATCTGGGCGACAGGCTCGGGGTTAGGGCGTGTG AGAAAGGAGGAGGCGCGGAAGCGCCATACCAGCTGAACGAGGAGAGAGAG GAGGAGGCAAAGGAAGTTGCGCTAGCCGCTTGACGAGGGAGGAGGAAGAA GTCCGTGCGGTTCGTGAGATGCGTGGACGGAGAAAACAAGTAACCGCCTG ACGGGAGATAGATGAGGAAAGACGACGGTGTTGAGGAAAGGTATAGCGTG TGCGCGCTTGAGATTATCAGCCAGATCAGCCAGTCATTCAGCAGTATTTT TCTTAAAAAAATCAGCCAGAACAAGCGAACAGGCTGGTAGTTGGGCTTTA ATGTTGTGGGTCCTACGTGTGGAGTCATCCCCGGTTCTATACATTATTGG TAGCGTTAAACAGATGACGTCTAATCAATCGTGAGACCCAACTAAGACCC AGGTGGGTTCTATACGCTCGACGGGATGACCATGACAATGATAGGGGATT GACCAACGATGTAAGTATGGATATGGATTAGAGCACAAAGAGAGAGTTTG ACTCCTAGACAAGGGGGGAAAGTAGAAAGTGATGGATAGAGACGCGACCA GAAGGAAATGTCCAGGCATAGATCCTACGTGTTGCAAAATAAAGAATTTT GAGTTCTATAAATCAAATCCAAGTTTTAAAAAAATTATATAATAGAATAT TAATATATATGACACTAATTTACTTCGTTAGATATACGCACTCTCGAACG AGCTAAAATATTAGAAGAAATAAACATTAGTTATTGTTACTAATGAAAAA TCTACATTAAATTGTATATTTTTCTTCTTGTTTATTTCTTAACACAACCA CCCCGCCTACTATAAATACAGGGCAAGCTCGCAAGCGTCGTCCTCGTCCT CGCCCCCACCCCCACCCTCGCCTCCACCACCAGTGACCGGCAGCGAGCCG CCTCGTCACGCCACCCACATCCACCCCACCTCTCGAACCCGCCCACACTA ACCCCAGGGCAGCGTGCCGGCGAGCTCGCCGCGACGCCCCCGCAACGACC TGGTCCGACCGTCTCCACCACCGCCAGGGCCCCAAACTGCCCCGCCGCCG TCCCCATCGCTTGGCCGGACCCGCCGGTGACCTCCTCGCCTTCTTCCTCT CTCGCGCGGGCGACGGCGCGCGCGAGGTGGAAGACGGTGCAGAAGGAGGT GCGGCATGAGATGGAAGCATATAAATAAGGGTCAGGCTAGTGCCCGGACG TCCGGCCCTGGGCCCTTGTCCGGACTTAGCTCCCCATGCCCCGCTTGTGC TCTGCACCGCACGCCCCATCCACTCAGATTCCGCGCCGCTCGGACGACTC GCCCCACCCACGCCGCCCCGCCCCCACGCGGGCCCACATCACCCGAACAT CACTAGCATCGAGAAGAGGAGGTGACATCGAGGCGAGACAGCAGAAGATG AGGAGAGAGATACAACACCCGATCTCTTTTGAAACATCCAAATGAAACAT TTGCAACATACGTTCGAAAACAGTTGAAACACTTGCAACATAGGTCTGAA ACACTTATAAAAACACCTGAAAACGCTTGAAAAGCTATTGCAAAATATAT GCAACATACGTCTATATGCAACCCGATCTAAATATATGCAACATATGTGT GAAACACGTGTAACATTTAGATAAACACACTTACAACATACGTCTGGAAA AACAACTGAAACATTGGGAATAAAAACTTGCAACATATGTTAACAACCAT TGCAACATATGCAACGTCCACGTGAAACACTTATAACATCCACATGAAAC ATCTAAAATACCTGAAACATACTATTGCAACATGCGTTTTCAGTGCGCAA TGTCACCTTGCTGCTTAGACGAATCACGAAGCTCGATGCCACCGCGACGC ATAGTGCTCGCCAGTGCACCCCTGGGCGAGGACCTGCTCGGCTGCCTGGG TGAGCACCTACGAGTGAGGTGCGCGAGCACCTGCTTCGCTTCCCGAGCCA AGGCACCCTGGGCGCGGCAGAGGACGGGCATGGCGCGGCGGGGGATGGAG GCGCTGCGGGGGATGGCGGCGGCGGTGCGTCGGAGTGTCCTGGCAGCGTC GGCAGTCGAGTGCTGCGTCTCGGAGGTGGTCGCGCCAGGCGAGCGGATAG AAACGAGTACGTGGATGAGCGGATTCTTTTTTTATTTAGAAACAGAGTAG CGGGGGGCCGGCGTGTTCTACGGTGTCCAGTGGACTGACGTCCCCTTAAT AGCATTAGCGTATAAATAAGTAATTACTTGGGCACGTCTTTCCCGGGGCC GGGGGGGCAAAGGGCGGGCGCGGACTGCCACTAGTTTCAATTTTGAATTT GAGTCGTGAGTGCTAAGCAGAGTAATGACGTTTAATAAGGAATTAGAAAC GGCACTCGATCGGCTGCCCACTGCCCATTGTTCTCCCAACTTCCAAGGAC GAGAGAATGAACACCAGAAACGTCAACCATGCATTCAGGACATGTACGGC GGCAATGAGTCGCTGAAAGCACGGGGCGCGCTCTCCATAGCAGTTCCCGG GGAGATCGCCGGCCTGTACGAGGCGTGGAAGCACCACGGCAAGCTCCCAT GGAAGCGTCTCGTCCTGCCGGCCGCGCGGCTGGCCTTGGCGTTCAGGATC TCGCCGTACCTGCGGATGCAGATGGAGGCGACCAGGGACGGCATCCTGGG CAACAACGGGACGCGGGCCGTGTACGCGCCGGGCGGCGACATCCTCACGG CCGGGGACGTGTGCCGCAACGCGAGGCTCGCCCAGACGCTGCGGGCCGTC GCGGAGCGAGGGCCCGGCGTGTTCTACGGCGGCGCCGTGGGGGCGCGGCT CGTGAGGGACGTCCGGGAGGCCGGAGGGATCCTGACGGTGGAGGACCTGA AGAGGTACCAGGTGAAAGTGCGGCGGCCGCTGACGGGGAACGTGATGGGG CTCCAGGTGGTGACCATGCCCCCGCCTTCCGCCGGCGGTGCCGGGATGAT GCTTGTGAGTTCATTATCTGGTTCTCTGCATTCTGATCACCGATCAATTC GTTCATGTTTAATTCCTTTGCTGATCTTGACTCACTTGTTCACTTATGGA TAGGTCCTGAACATCCTTGATCAGTATGGCATTCCTGCTGGTTTCGCTGG CTCTCTTGGGATTCATCGCCTCATCGAGTCCTTGAAACATTACATGGCCG TAAAGATGAACCTTGGCGATCCTGACTTCGTCAATGATAGCGAGGTTGTG TCTGATATGATTTCCCCCAAATTTGCTGCTGAACTGAAGAAAACCATTTA TGACAACATGACATTTGCGCCTAAACATTACGGTGGAAGGTAAAGACTTT CTGAATGCTATCGGTGATCGATGTTCATTACCTCACAGGTTCAGTTCCAC GTCCCATTGCCATCTTTGCTGATCCTGATCAACTTGTGTTTTTTCAGGTG GAACATCCTTCAGGACCATGGAACCAGCCACCTGTCCATCGTCGACAGCG AGCGAAACGCAGTTTCGATGACGAGCACCGTCAACGCGTACTTCGGATCA CTGATCCTTTCCCCACGCACGGGTATCCTGCTCAACAACGAGATGGATGA CTTCTCCATGCCGGCGAACACGTCGGAGAATTCCCCACCGCCAGCACCTG CCAATTTCGTCAGCCCTTTGAAACGGCCTCTCTCTTCCATGAATCCGACC ATAGTTGTCAAGGTAAACTATATATATAGCGCGTAAAAGAAGCTGAGACG ATCTGAAATGAGCTCATCAGACCATGTTTCTGATGATAGCTTGACTGTTT TGTCATGTGCTGCATTTGCATAGGACGGGAAGCTGATGGCTGCAGTTGGT GCCAGTGGTGGCAGCATGATCCCCGCTGGAACGATCGAGGTGTTCATCAA CCATTTCGTCAAGAACATGGATCCATTGGCTTCTGTCATGGCGCCAAGGG TGTATCACCAGGTTTGATACTTATATTTGGTGAAAAATAGCTTACTCCTG TATTCCACGCACGGCGCTGATGCCGTCAGGTGTCACCCTGAGATTGAGAG ACATGTCACCGACCGGCTAGATAATCTTTCTTCTGAGCTTGGTTTTGGTT GCCATGTCCGCAGCTGATCCCAAACGAGGTCAAGTACGAGAACTGGACGA CGGTGACCGGCGACCACTTCGAGCTCGACGCCGCGACGAGGGCCGACCTG CAGAAGAGAGGCCACGTCCTGAAGCCGCTTGCCGGGGGAACCATAAGCCA GCTCGTGGTGCACAACGTCGGGCGGCAAGGCGACCTGACCGCCGTCAGTG ACCCCAGAAAAGGCGGTGTCCCGGCTGGCTACTGAGCAGGATCGAAGCAC GGTTAATTAGTCCTCTGCTGATGTGTGTGTGATGTGTGACGGAGCCAGGA AGAGAATATGGATAGCTCATCTCTTTAGGCTCTTGTGGTGGGACATGACA AGGTTTTTTTTTACCGGTAGGAAAAAAATTTCAGTCCCTGGCGATAAATA TGAAATTTCAGAAATTTCGGAAATATCGGGTCAAATT
back to top