Sh_004O05_g000060

Overview
NameSh_004O05_g000060
Unique NameSh_004O05_g000060
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length222
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_004O05contigSh_004O05:44183..44404
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NoteConserved hypothetical protein
TypemRNA
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_004O05_t000060Sh_004O05_t000060R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_004O05_g000060 ID=Sh_004O05_g000060|Name=Sh_004O05_g000060|organism=R570 Sugarcane cultivar|type=gene|length=222bp
ATGTTGAGTAATGAAAAAGTGGCCAAGGCAACTGTTGTTTCAGTTAATCC
AAACAATAAGCTAGCGGGTGTGGCTCTTGGAACAAAATTTTGTGAAGTGA
TTGTGAATGTTGTGCTCCGACGTGAAACATTAGTGCCACGTCCTTATGCT
GAAATCAAGACCCTAGGGGATGCTGTAAAGATGCCGGTTGCCTGGCCATT
TAATCGAGTAATGTCCACTTGA
back to top

gene from alignment at Sh_004O05:44183..44404+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_004O05_g000060 ID=Sh_004O05_g000060|Name=Sh_004O05_g000060|organism=R570 Sugarcane cultivar|type=gene|length=222bp|location=Sequence derived from alignment at Sh_004O05:44183..44404+ (R570 Sugarcane cultivar)
ATGTTGAGTAATGAAAAAGTGGCCAAGGCAACTGTTGTTTCAGTTAATCC AAACAATAAGCTAGCGGGTGTGGCTCTTGGAACAAAATTTTGTGAAGTGA TTGTGAATGTTGTGCTCCGACGTGAAACATTAGTGCCACGTCCTTATGCT GAAATCAAGACCCTAGGGGATGCTGTAAAGATGCCGGTTGCCTGGCCATT TAATCGAGTAATGTCCACTTGA
back to top