Sh_005D21_g000060

Overview
NameSh_005D21_g000060
Unique NameSh_005D21_g000060
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length6702
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_005D21contigSh_005D21:62418..69119
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NoteChaperone protein ClpC2, chloroplastic
TypemRNA
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_005D21_t000060Sh_005D21_t000060R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_005D21_g000060 ID=Sh_005D21_g000060|Name=Sh_005D21_g000060|organism=R570 Sugarcane cultivar|type=gene|length=6702bp
GCGGCCCCCTTATCTCCAGGGACCAGGGGAGGACGCACACCAACGCACCG
CCCTTCCCTTCCCTCCTCCTCCTCCTCTTCCTCTCTCCTCGGAAGGTGAG
CACCCCCAGCGATCCTCTCGTTGTCTTCTGTGTGTGAGTTCTTCGTTCTT
GGGTGGGATTCTTGCCTGCTACGGGCTCCTGATTCTCATGTCGAGATTTC
CATTCCTGGATACATGGATGGATGGATGGATGGATTAGTAATCGTGTGTT
GTCGGTGGGCTCTGATTCTTATCCGCGGAATCCCTTCATAATTTTGGGGG
GAAATTCTTGATTTTTTTTGTTCAGTTTTGGGTGTGGATAAGCCGCAAGG
TTCATCTTTCTCCGTCTTTAGATATTATCGATGCCAATGCGAGGTTGAAA
TACTGTAATTGATATTCTCTGTCGCCGGAAATGAAACATCTTTTTGTGAG
CCCGCAATTCCAAATCTTTGCTCGTTGTATCGGTGCCCCAATCCGTCCAG
ATTTCCGCGGATTGATTTGCTAGGAAGCGGGTGAACATCTACCGCTGTTT
TTAAGCCTGTCTTCCTATTTCTAGCACATTTAATTTTTCCATTTTTGTTT
GGCACAGTTTTTCTCCATTTCTTAGCACATTTTGTTGTTGCAATTTGTTT
GGGGTCAGATGGATCAAGAGCAGCATACTGATGTTTGGCACGCGCTATTC
CTGCGCATGATTAGAATTGACCCTTTGTGTTTATCTGAGAACTTTAGAAG
ATTGGTTTGTAATATTTGATTAACCGTTGTAATGTCTGGTGCAGGATAAG
GGACAGTATTTCTGACCATGGCAGGGACCTTACTCCAGTCAGTTGCCCTC
GGAACAACATTTGGGGGGCGCATAAGCACCCAGCGCTGGAGGTCCCATGG
CACCAGGAGGCCTGCCTCTATGTTGGCAATGTCACTTAGCCGCCCTGTCA
AGATGTCAGCATTTGTGGGTCTAAGATCAGTGCATAGCTTCTCGGTCACA
CCCACGGTGTCCAATTCTAGGCCGACAGTTGCATCTTACAGGTCGTCTCG
ACGGACAAGACGTTCTCGTTTTGTTACTCGGGCAATGTTTGAGAGGTTCA
CGGAAAAAGCTATTAAGGTCATCATGCTTGCGCAAGAGGAAGCAAGGCGC
CTGGGGCACAACTTTGTTGGAACTGAGCAGATTCTCTTGGGTCTGATTGG
AGAGGGCACTGGTATTGCAGCAAAGGTGCTCAAGTCCATGGGAATAAATC
TCAAGGATGCACGTGTGGAGGTGGAAAAGATTATTGGCCGCGGCAATGGT
TTTGTTGCTGTTGAAATACCATTCACACCACGCGCAAAACGTGTTTTGGA
GCTCTCCTTGGAGGAAGCTCGCCAATTAGGTATGTTGTTTATCTAGGCTT
CTTGTTGAATGTTGTCCTTGTTGCATTGTCGTAAATTTCATTTCCTATTC
TCTCTAATTCATGCACGAAAACATAGTAGAAGGAATTGCTGGTCAAGGTC
CTTGTGATACCTTTTTGGTCTTATCTTCTAATTTTACTTATTCGCTACTC
GAACAAAAATCGATTAGAAGAATGTCCCTATTGACCAATGTTCTATTTCC
CCAAAAGGAATTTCATTTTCCTATTACTTGATTACTTCCATGCTTGTGCT
TTTTTCTAGAGAGTTCTAGAAAGCTTCCAGTTAGCATATTTTTCGATGAA
ACTTTTTGCCTAAAATACAGTGTACAAATTGTTGATTGTCGGATACAAAT
ATATCAATTGCATTTTGACAGAGCTTCCATTGCACATTCCCATAAGTATT
GAAGTCATCGTTCTTAACTGATGTCAGAGGGACCCTGACGTGATAATGGA
CAGTTGATTGCAATATTTTACATGTAGTTAATCTTCCAGATCTGTCTGTT
TTATGTCACCTTTTTAAGTATTCAAGTGGAAGTTGCGAAGTACAATGAAG
CATCATAATCTCATCGCAATCATCATAATCTCATCGCAATCCACTTAGTG
TGGTGCTATTTTATATCTTCATCTCGAACATATTTTATATCTTCATCAAA
GAAACTTTTGTAGTAATACAAGCTGAAAAATAACAATGACCCCAGTGGCA
GGTGGCTTGCATCCCCATTTATGAGCATATTTCCGAACTTCTACACATTT
GCATCATTAAACTATTTTCACATTCGATAATTTAGGTCTTAGGATGCAGT
TGAACTAATAGATGCATTTCTTTCTTCATTGTCCTGCTTTGTGCACCTAT
AAAGAAATTTTCTGCTGTGCACCTGTTTCTCGTCTCTTTTGGGTTTCATC
TCTAGCCTACCCCAACTTGCTTGGGACAAAAGGCTATGTTGTTGTTGTTG
TTGCACCTGTATATGTAAAGTAATCCCTCCCTGCTTTCTCATCTAATATG
GTAACAGACGAACACCCTTGGCCTTTATCTTGTTCCTCAACTAAATTACA
TGTACTTCCTATGTTGGTAATTGTCAAGACATTTATCTTAACAAGAATAT
CATTTCCTTCTATGTATCAAACCACAGCACACTCCATTTCCTCATTATAT
TTCGATTTTTGAATAAGTTCCATATAAGATTTATCTCAGCACTAAATACT
TGCTTCCCAGGACATAATTATATTGGATCTGAGCACCTGCTTCTTGGACT
GCTTCGTGAGGGTGAAGGTGTGGCAGCTCGTGTGCTTGAGAGTCTCGGAG
CTGACCCCAGCAATATCCGTACACAGGTAAACCTATATCTGATGTCTATT
TTTGACAGTAGGGAGTTCTCTGTACAAAAAGAAATTCTGTTTATTAGCTG
TTTCTTCAATGTCATGGACCTCTATAGGTTATTCGAATGATTGGTGAGAC
CACAGAAGCTGTTGGTGCTGGAGTTGGAGGGGGCAGCAGTGGTAATAAGA
TGCCAACTCTTGAGGAGTATGGAACTAATTTAACAAAATTAGCAGAGGAG
GTAATATTTCTGACCTACTGGCTACTGCATTATAACCAGCACAAGTTCTG
TAATAGAACTCATGTTGTTCATATCTGCAGGGAAAATTAGATCCTGTTGT
TGGAAGGCAGCCACAGATTGAGCGTGTGGTACAAATTTTAGGCAGACGAA
CCAAGAACAATCCCTGCTTGATTGGAGAGCCTGGTGTTGGAAAGACTGCA
ATTGCTGAAGGACTTGCTCAACGCATTTCTACAGGCGATGTACCTGAAAC
AATAGAAGGGAAAAAGGTACCCTTTTTGCATCATTTCAAAGCAATTATGC
AATATGTATCTATCTATTTATAGTATTTTGCTGTCAATTCATTCTACATC
TATTGTGAACATATGAGCTTGAATAATATTTTGTTCTTGTGTACTGTTGT
TTAGTTGTGTATGGTATATTTATGCAGCTTTACATGAGGGTGCATGCATG
TGTTGCTCTTATCTCTCATTTTACTCGAGTTATCCCATCCAGTGGACATT
TAAGTATGTAAGCACAGTTTAGTGATTGAAGAACCTGCTCGTAGAAATAA
TCATCTATACTAGCTAGCACACTGATTGAGCAAATAGAAGAAGAAAGTAT
GTTGTAACTATTTGTACTCTTTTGTGATACATGAGATCAGAATTTCTAAG
TGATTAATCTCAGCTCACTGGTCGATTCTGTGGTCTAGTAATTGTTCAAG
TGGTTGTACTTTTCTGCCACATTTCTGTATTCTTTTGATGAGATTGTGAG
GAAATGATGGATATTCCTTCAACCAATTTACCACAGGTCATTACCCTTGA
CATGGGACTTCTTGTTGCTGGCACAAAATACCGTGGAGAATTTGAAGAAA
GATTAAAGAAGCTGATGGAGGAAATAAAGCAAAGTGATGAGATAATACTC
TTTATTGATGAAGTTCACACTCTGATAGGAGCAGGAGCAGCCGAAGGTGC
TATAGATGCTGCTAATATCTTGAAGCCTGCATTGGCCAGAGGTGAATTAC
AGGTGTGTAGATAACATGTTCCTATGCTGTGGTGAACATTCTCTGATCTG
TTCTTTTGGAATAAGTCCAGTATCTTGTCCTTCAAGATGAGCTTTCCAGC
GCTCTTGCTTGTAATGAGGTTGTTATGACTAACCTATTATGTTTAATTGC
AGTGCATTGGAGCGACTACACTTGATGAATATAGGAAGCACATTGAGAAA
GACCCAGCACTTGAACGGCGGTTTCAACCTGTGAAAGTGCCAGAACCAAC
AGTAGATGAAACCATTGAAATTCTCAGAGGACTAAGGGAACGATATGAGA
TCCACCATAAACTTCGTTACACTGATGAAGCTCTGATTGCAGCTGCAAAG
CTGTCATATCAATATATCAGGTCTGTGAACTGTAAATAAAAATATATCAC
ATGCATCAGCTGAAAATGTAAAAACACCACAAAGAAAAATTTTGTTGGAA
CTTTAGCTTGCATCTCTGAAAAAACAACTATGTTTGCGTGATTACTTCCA
TCCACAATTTATTTTTGAACTTTATTGCATCCTAATGATCATCTGACAGC
ATATTTCTGTTTGCAGTGATCGTTTCCTCCCAGATAAGGCAATTGACTTG
ATTGATGAAGCAGGTTCCCGTGTTAGGCTACAGCATGCACAGGTACCAAG
TCATGCTTTCATTTATTTGTATGCTTTATTCTTGCATGCCCTAAACAGTA
TCTACATTTTACTTTTGGTGCAGGTTCCTGAGGAAGCAAGAGAGCTTGAC
AAGGAGCTCAAACAAATCACGAAACAGAAGAATGAAGCTGTTCGTAGCCA
GGATTTCGAGAAGGTAATTGACTATGGATGATCTGTTACATTTTACATCT
CTTTCAAATTTGTGACACAACTTAAATGTTGCCTGGCCTCCTGAAGATCA
TATTAAATTTTAATTTCCATCCACCATAACTGTTCTAATTACAATAGCTT
GTACATAGAAAATATTCAGTAGAGTTTTGGAGGATTACAAATAATTTTGG
ATGATTCAGTAATTCTTGTTTATTTCATCAAGCAATGCTCTTACTTGAGT
GAAGTTCCCCATTTCCATTTTAGGATGTACTAAAACAATCAGAGTTAAAA
AGTTGTTACATGCTTTTGGTTTAAAATAGGTATCAGTGATAGTTTTATTT
GAACACAAGTTATCAGTGATAGTAACATGCCCCTTAATGTTCATTCGTCT
ATGCACTTTCTTTCTTTCTGTTCTTTTGTTTATTTAGCAATTTGCACCTG
CTTCAATTGGATATGTGGACGCCCTTTCTCTGCCTTCTCCCTGTACTTTC
ATTACTTAATGGTTTGCACCTTTTCTAGATACAGATGTTCTTTCATAGCT
AATTTCCCTTTTTAAATGTTATGTCATTAGGCTGGGGAATTGCGAGACCG
TGAAATGGAATTGAAGGCCCAGATAACAGCCTTCATTGACAAGAGCAAGG
AATTGACCAAAGCAGAGGAAGAGTCTGGAGAGACAGGACCTATGGTCAAT
GAAGCAGATATCCAACACATAGTATCGTCATGGACTGGCATCCCTGTGGA
GAAGGTTTCCAGCGATGAATCTGATAAGCTTCTTAAGATGGAAGAGACTT
TGCACAAGCGTGTCATTGGCCAAGATGAGGCTGTGGTAGCAATTAGTCGC
TCCATCCGCCGTGCTCGTGTGGGTCTGAAGAACCCCAACAGGCCAATAGC
AAGCTTTATTTTTGCAGGTCCCACCGGTGTTGGGAAGTCAGAGCTTGCAA
AGGCTCTTGCAGCCTATTACTTTGGCTCTGAGGAGGCTATGATCCGGCTT
GATATGAGTGAATTCATGGAGAGGCACACAGTATCCAAGCTGATTGGTTC
ACCTCCAGGATATGTAGGATACACTGAGGGAGGCCAGCTGACAGAGGCAG
TTCGACGGCGGCCATACACAGTTGTGCTCTTTGATGAGATTGAGAAGGCA
CACCCGGATGTCTTCAACATGATGCTTCAGATTTTGGAAGATGGGAGATT
GACTGACAGCAAGGGAAGGACTGTAGACTTCAAGAACACACTCCTGATCA
TGACCTCAAATGTAGGGAGCAGCGTCATCGAGAAGGGTGGGCGGAAGATC
GGATTTGACCTTGACTCTGATGAGAAGGACAGCAGCTACAGCAGGATCAA
GAGCCTGGTCATCGAGGAGATGAAGCAGTACTTCCGACCTGAGTTCCTCA
ACCGTCTCGATGAGATGATCGTGTTCAGGCAGCTGACCAAGCTCGAGGTC
AAGGAGATCGCGGATATCATGCTTCAGGAGGTCTTTGACAGGCTGAAGGC
CAAGGACATCAATCTGCAAGTGACCGAGAAGTTCAAGGAGCGGGTGGTGG
ACGAAGGCTACAACCCTAGCTACGGTGCACGCCCGCTGAGGCGAGCCATC
ATGAGGCTGCTGGAGGACAGCCTTGCTGAGAAGATGCTCGCCGGGGAGGT
AAAGGAGGGTGACTCTGCCATAGTGGATGTGGACTCGGAGGGGAAGGTCA
TCGTGCTCAATGGCCAAGGCGGCATACCGGAGCTCCCAACTCCGGCGATC
ACCGTTTAGCTCGTACATAACAGATGATGACAAAATAGCAGAGTTTTTGT
TTCAAACACATTATCATATATAGTTAGCATATAACTGTGTATATGTAGTG
GTATAGTCAAAGGGGAAATCGTTGCTGCCTTTGAATTCCTTTTCAAATTC
AAATATTCTTTTGTCTCTCAAGTTAATCTGCCTAGTTATTAAGGTATATT
GT
back to top

gene from alignment at Sh_005D21:62418..69119+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_005D21_g000060 ID=Sh_005D21_g000060|Name=Sh_005D21_g000060|organism=R570 Sugarcane cultivar|type=gene|length=6702bp|location=Sequence derived from alignment at Sh_005D21:62418..69119+ (R570 Sugarcane cultivar)
GCGGCCCCCTTATCTCCAGGGACCAGGGGAGGACGCACACCAACGCACCG CCCTTCCCTTCCCTCCTCCTCCTCCTCTTCCTCTCTCCTCGGAAGGTGAG CACCCCCAGCGATCCTCTCGTTGTCTTCTGTGTGTGAGTTCTTCGTTCTT GGGTGGGATTCTTGCCTGCTACGGGCTCCTGATTCTCATGTCGAGATTTC CATTCCTGGATACATGGATGGATGGATGGATGGATTAGTAATCGTGTGTT GTCGGTGGGCTCTGATTCTTATCCGCGGAATCCCTTCATAATTTTGGGGG GAAATTCTTGATTTTTTTTGTTCAGTTTTGGGTGTGGATAAGCCGCAAGG TTCATCTTTCTCCGTCTTTAGATATTATCGATGCCAATGCGAGGTTGAAA TACTGTAATTGATATTCTCTGTCGCCGGAAATGAAACATCTTTTTGTGAG CCCGCAATTCCAAATCTTTGCTCGTTGTATCGGTGCCCCAATCCGTCCAG ATTTCCGCGGATTGATTTGCTAGGAAGCGGGTGAACATCTACCGCTGTTT TTAAGCCTGTCTTCCTATTTCTAGCACATTTAATTTTTCCATTTTTGTTT GGCACAGTTTTTCTCCATTTCTTAGCACATTTTGTTGTTGCAATTTGTTT GGGGTCAGATGGATCAAGAGCAGCATACTGATGTTTGGCACGCGCTATTC CTGCGCATGATTAGAATTGACCCTTTGTGTTTATCTGAGAACTTTAGAAG ATTGGTTTGTAATATTTGATTAACCGTTGTAATGTCTGGTGCAGGATAAG GGACAGTATTTCTGACCATGGCAGGGACCTTACTCCAGTCAGTTGCCCTC GGAACAACATTTGGGGGGCGCATAAGCACCCAGCGCTGGAGGTCCCATGG CACCAGGAGGCCTGCCTCTATGTTGGCAATGTCACTTAGCCGCCCTGTCA AGATGTCAGCATTTGTGGGTCTAAGATCAGTGCATAGCTTCTCGGTCACA CCCACGGTGTCCAATTCTAGGCCGACAGTTGCATCTTACAGGTCGTCTCG ACGGACAAGACGTTCTCGTTTTGTTACTCGGGCAATGTTTGAGAGGTTCA CGGAAAAAGCTATTAAGGTCATCATGCTTGCGCAAGAGGAAGCAAGGCGC CTGGGGCACAACTTTGTTGGAACTGAGCAGATTCTCTTGGGTCTGATTGG AGAGGGCACTGGTATTGCAGCAAAGGTGCTCAAGTCCATGGGAATAAATC TCAAGGATGCACGTGTGGAGGTGGAAAAGATTATTGGCCGCGGCAATGGT TTTGTTGCTGTTGAAATACCATTCACACCACGCGCAAAACGTGTTTTGGA GCTCTCCTTGGAGGAAGCTCGCCAATTAGGTATGTTGTTTATCTAGGCTT CTTGTTGAATGTTGTCCTTGTTGCATTGTCGTAAATTTCATTTCCTATTC TCTCTAATTCATGCACGAAAACATAGTAGAAGGAATTGCTGGTCAAGGTC CTTGTGATACCTTTTTGGTCTTATCTTCTAATTTTACTTATTCGCTACTC GAACAAAAATCGATTAGAAGAATGTCCCTATTGACCAATGTTCTATTTCC CCAAAAGGAATTTCATTTTCCTATTACTTGATTACTTCCATGCTTGTGCT TTTTTCTAGAGAGTTCTAGAAAGCTTCCAGTTAGCATATTTTTCGATGAA ACTTTTTGCCTAAAATACAGTGTACAAATTGTTGATTGTCGGATACAAAT ATATCAATTGCATTTTGACAGAGCTTCCATTGCACATTCCCATAAGTATT GAAGTCATCGTTCTTAACTGATGTCAGAGGGACCCTGACGTGATAATGGA CAGTTGATTGCAATATTTTACATGTAGTTAATCTTCCAGATCTGTCTGTT TTATGTCACCTTTTTAAGTATTCAAGTGGAAGTTGCGAAGTACAATGAAG CATCATAATCTCATCGCAATCATCATAATCTCATCGCAATCCACTTAGTG TGGTGCTATTTTATATCTTCATCTCGAACATATTTTATATCTTCATCAAA GAAACTTTTGTAGTAATACAAGCTGAAAAATAACAATGACCCCAGTGGCA GGTGGCTTGCATCCCCATTTATGAGCATATTTCCGAACTTCTACACATTT GCATCATTAAACTATTTTCACATTCGATAATTTAGGTCTTAGGATGCAGT TGAACTAATAGATGCATTTCTTTCTTCATTGTCCTGCTTTGTGCACCTAT AAAGAAATTTTCTGCTGTGCACCTGTTTCTCGTCTCTTTTGGGTTTCATC TCTAGCCTACCCCAACTTGCTTGGGACAAAAGGCTATGTTGTTGTTGTTG TTGCACCTGTATATGTAAAGTAATCCCTCCCTGCTTTCTCATCTAATATG GTAACAGACGAACACCCTTGGCCTTTATCTTGTTCCTCAACTAAATTACA TGTACTTCCTATGTTGGTAATTGTCAAGACATTTATCTTAACAAGAATAT CATTTCCTTCTATGTATCAAACCACAGCACACTCCATTTCCTCATTATAT TTCGATTTTTGAATAAGTTCCATATAAGATTTATCTCAGCACTAAATACT TGCTTCCCAGGACATAATTATATTGGATCTGAGCACCTGCTTCTTGGACT GCTTCGTGAGGGTGAAGGTGTGGCAGCTCGTGTGCTTGAGAGTCTCGGAG CTGACCCCAGCAATATCCGTACACAGGTAAACCTATATCTGATGTCTATT TTTGACAGTAGGGAGTTCTCTGTACAAAAAGAAATTCTGTTTATTAGCTG TTTCTTCAATGTCATGGACCTCTATAGGTTATTCGAATGATTGGTGAGAC CACAGAAGCTGTTGGTGCTGGAGTTGGAGGGGGCAGCAGTGGTAATAAGA TGCCAACTCTTGAGGAGTATGGAACTAATTTAACAAAATTAGCAGAGGAG GTAATATTTCTGACCTACTGGCTACTGCATTATAACCAGCACAAGTTCTG TAATAGAACTCATGTTGTTCATATCTGCAGGGAAAATTAGATCCTGTTGT TGGAAGGCAGCCACAGATTGAGCGTGTGGTACAAATTTTAGGCAGACGAA CCAAGAACAATCCCTGCTTGATTGGAGAGCCTGGTGTTGGAAAGACTGCA ATTGCTGAAGGACTTGCTCAACGCATTTCTACAGGCGATGTACCTGAAAC AATAGAAGGGAAAAAGGTACCCTTTTTGCATCATTTCAAAGCAATTATGC AATATGTATCTATCTATTTATAGTATTTTGCTGTCAATTCATTCTACATC TATTGTGAACATATGAGCTTGAATAATATTTTGTTCTTGTGTACTGTTGT TTAGTTGTGTATGGTATATTTATGCAGCTTTACATGAGGGTGCATGCATG TGTTGCTCTTATCTCTCATTTTACTCGAGTTATCCCATCCAGTGGACATT TAAGTATGTAAGCACAGTTTAGTGATTGAAGAACCTGCTCGTAGAAATAA TCATCTATACTAGCTAGCACACTGATTGAGCAAATAGAAGAAGAAAGTAT GTTGTAACTATTTGTACTCTTTTGTGATACATGAGATCAGAATTTCTAAG TGATTAATCTCAGCTCACTGGTCGATTCTGTGGTCTAGTAATTGTTCAAG TGGTTGTACTTTTCTGCCACATTTCTGTATTCTTTTGATGAGATTGTGAG GAAATGATGGATATTCCTTCAACCAATTTACCACAGGTCATTACCCTTGA CATGGGACTTCTTGTTGCTGGCACAAAATACCGTGGAGAATTTGAAGAAA GATTAAAGAAGCTGATGGAGGAAATAAAGCAAAGTGATGAGATAATACTC TTTATTGATGAAGTTCACACTCTGATAGGAGCAGGAGCAGCCGAAGGTGC TATAGATGCTGCTAATATCTTGAAGCCTGCATTGGCCAGAGGTGAATTAC AGGTGTGTAGATAACATGTTCCTATGCTGTGGTGAACATTCTCTGATCTG TTCTTTTGGAATAAGTCCAGTATCTTGTCCTTCAAGATGAGCTTTCCAGC GCTCTTGCTTGTAATGAGGTTGTTATGACTAACCTATTATGTTTAATTGC AGTGCATTGGAGCGACTACACTTGATGAATATAGGAAGCACATTGAGAAA GACCCAGCACTTGAACGGCGGTTTCAACCTGTGAAAGTGCCAGAACCAAC AGTAGATGAAACCATTGAAATTCTCAGAGGACTAAGGGAACGATATGAGA TCCACCATAAACTTCGTTACACTGATGAAGCTCTGATTGCAGCTGCAAAG CTGTCATATCAATATATCAGGTCTGTGAACTGTAAATAAAAATATATCAC ATGCATCAGCTGAAAATGTAAAAACACCACAAAGAAAAATTTTGTTGGAA CTTTAGCTTGCATCTCTGAAAAAACAACTATGTTTGCGTGATTACTTCCA TCCACAATTTATTTTTGAACTTTATTGCATCCTAATGATCATCTGACAGC ATATTTCTGTTTGCAGTGATCGTTTCCTCCCAGATAAGGCAATTGACTTG ATTGATGAAGCAGGTTCCCGTGTTAGGCTACAGCATGCACAGGTACCAAG TCATGCTTTCATTTATTTGTATGCTTTATTCTTGCATGCCCTAAACAGTA TCTACATTTTACTTTTGGTGCAGGTTCCTGAGGAAGCAAGAGAGCTTGAC AAGGAGCTCAAACAAATCACGAAACAGAAGAATGAAGCTGTTCGTAGCCA GGATTTCGAGAAGGTAATTGACTATGGATGATCTGTTACATTTTACATCT CTTTCAAATTTGTGACACAACTTAAATGTTGCCTGGCCTCCTGAAGATCA TATTAAATTTTAATTTCCATCCACCATAACTGTTCTAATTACAATAGCTT GTACATAGAAAATATTCAGTAGAGTTTTGGAGGATTACAAATAATTTTGG ATGATTCAGTAATTCTTGTTTATTTCATCAAGCAATGCTCTTACTTGAGT GAAGTTCCCCATTTCCATTTTAGGATGTACTAAAACAATCAGAGTTAAAA AGTTGTTACATGCTTTTGGTTTAAAATAGGTATCAGTGATAGTTTTATTT GAACACAAGTTATCAGTGATAGTAACATGCCCCTTAATGTTCATTCGTCT ATGCACTTTCTTTCTTTCTGTTCTTTTGTTTATTTAGCAATTTGCACCTG CTTCAATTGGATATGTGGACGCCCTTTCTCTGCCTTCTCCCTGTACTTTC ATTACTTAATGGTTTGCACCTTTTCTAGATACAGATGTTCTTTCATAGCT AATTTCCCTTTTTAAATGTTATGTCATTAGGCTGGGGAATTGCGAGACCG TGAAATGGAATTGAAGGCCCAGATAACAGCCTTCATTGACAAGAGCAAGG AATTGACCAAAGCAGAGGAAGAGTCTGGAGAGACAGGACCTATGGTCAAT GAAGCAGATATCCAACACATAGTATCGTCATGGACTGGCATCCCTGTGGA GAAGGTTTCCAGCGATGAATCTGATAAGCTTCTTAAGATGGAAGAGACTT TGCACAAGCGTGTCATTGGCCAAGATGAGGCTGTGGTAGCAATTAGTCGC TCCATCCGCCGTGCTCGTGTGGGTCTGAAGAACCCCAACAGGCCAATAGC AAGCTTTATTTTTGCAGGTCCCACCGGTGTTGGGAAGTCAGAGCTTGCAA AGGCTCTTGCAGCCTATTACTTTGGCTCTGAGGAGGCTATGATCCGGCTT GATATGAGTGAATTCATGGAGAGGCACACAGTATCCAAGCTGATTGGTTC ACCTCCAGGATATGTAGGATACACTGAGGGAGGCCAGCTGACAGAGGCAG TTCGACGGCGGCCATACACAGTTGTGCTCTTTGATGAGATTGAGAAGGCA CACCCGGATGTCTTCAACATGATGCTTCAGATTTTGGAAGATGGGAGATT GACTGACAGCAAGGGAAGGACTGTAGACTTCAAGAACACACTCCTGATCA TGACCTCAAATGTAGGGAGCAGCGTCATCGAGAAGGGTGGGCGGAAGATC GGATTTGACCTTGACTCTGATGAGAAGGACAGCAGCTACAGCAGGATCAA GAGCCTGGTCATCGAGGAGATGAAGCAGTACTTCCGACCTGAGTTCCTCA ACCGTCTCGATGAGATGATCGTGTTCAGGCAGCTGACCAAGCTCGAGGTC AAGGAGATCGCGGATATCATGCTTCAGGAGGTCTTTGACAGGCTGAAGGC CAAGGACATCAATCTGCAAGTGACCGAGAAGTTCAAGGAGCGGGTGGTGG ACGAAGGCTACAACCCTAGCTACGGTGCACGCCCGCTGAGGCGAGCCATC ATGAGGCTGCTGGAGGACAGCCTTGCTGAGAAGATGCTCGCCGGGGAGGT AAAGGAGGGTGACTCTGCCATAGTGGATGTGGACTCGGAGGGGAAGGTCA TCGTGCTCAATGGCCAAGGCGGCATACCGGAGCTCCCAACTCCGGCGATC ACCGTTTAGCTCGTACATAACAGATGATGACAAAATAGCAGAGTTTTTGT TTCAAACACATTATCATATATAGTTAGCATATAACTGTGTATATGTAGTG GTATAGTCAAAGGGGAAATCGTTGCTGCCTTTGAATTCCTTTTCAAATTC AAATATTCTTTTGTCTCTCAAGTTAATCTGCCTAGTTATTAAGGTATATT GT
back to top