Sh_005H13_contig-1_g000020

Overview
NameSh_005H13_contig-1_g000020
Unique NameSh_005H13_contig-1_g000020
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length1920
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_005H13_contig-1contigSh_005H13_contig-1:14065..15984
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NotePutative protein
TypemRNA
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_005H13_contig-1_t000020Sh_005H13_contig-1_t000020R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_005H13_contig-1_g000020 ID=Sh_005H13_contig-1_g000020|Name=Sh_005H13_contig-1_g000020|organism=R570 Sugarcane cultivar|type=gene|length=1920bp
ATGGCGTCGCTGTTCCGTTCGATCCTCCGGCTATTCCAAGCGAAGGCGCC
GGGGCCGGAGCTTCTGGATCTCAGCGACGATCTCCTCCGGGAGATCCTCC
TGCGGATCGGCTTCCCCGCCGACGTCATCCGCGCCTCCGCCGCATGCGTC
ACATTCCGCCGCCTCGTCGCCGAACCCTCCTTCTTCTGCCGTTACCGCTC
CCTCCATCCTCCGCTACTCCTCGGCTTCCTCGAAACCAGAACCAAATTGT
TCCAGCCGGCCGAGGCGCCCCACCCCAACGCTCCTGCCGCCCGCGCTCTC
GCCCGCACCGCGAGCTTCTCCTCCGAGGATCGGCTCCCTCGCCTCCACAT
AGTTTCGTACTGCACTGGCCCTGGGAGATCTGTGACCTCCGCGAAGGCCG
TGTCCTCCTCAAGTGCAGACCTCTGGGATTTACATTCAGGGTCGCCTGCT
GCTACCTCGCATTTCCGACGACCTACTCGCCTCCGTTCAGGTTCAGCGAT
GTAACATTCCATGTTTCGAGGCCTTCCTTGTCCCTTCTTCTGCAGAAGAG
GAGGATGAGAGGTCGTTCAGAGTGATCGGCATGGCCATGACGGGTTGCAT
GACGAAGCTAGCGGTATTTGTCTTCTCCTCGAGCTCTGGGCGCTGGAGTC
TCGGTACGTCTACAAATTTGGATACTCTTAATGTACCACCAGACATAAAG
ATGCTGAAACAGCCCCATCTTTCTCATGGCTGTTTCTTCTGGAAAGTGGA
GAAGAAGGACAAGTTGCTCAAGCTTGACATGAGCATAATGGAGCTCTCCA
CATACGACCTCCCGCCTGGTCACCATGAGCGCTATACTGTCGTTGCAGAG
GCAGGTGAAGGAAGACTTGCGTTGTTTAGCTGCCCACGCTCTTCTGAAGA
AACATATGTGGATTATTACACCAGCATTATGCAAACCAAGAGCGACAGGG
ACAAGGAGTGGCAGATGATAACCATAATCCCACTTCCCCCCAATCATCGG
TATGAGATTTGTGGTGCAGCTGACGGATACATTTTCCTATTAGGATTTCC
AAAATTCCCAGGACCGGGTCATGCAGTTTGTTTATCCCTCGAGGTTAAGA
ATTTGAGGATTGAGAGGGTGTGTTCTGCAATGCGCCGAAGTGGTGTCCTG
CACCCGTATTTCGGGTACCCACCACCCATGTCACCGAAAGTCATACCAAG
CGATACCGGCTTCTGCCCCCCATACCCGACAACCTCGCCTCCGTCCACGT
CCATCTGCAAAATTGTCAATCTTTCGAGGCCTTCTTTGCACCTATTGGAG
AAGAGGAGGATAATACATCGTTCAGAGTGATCGGCAGGGCACATTGCCCG
ATCAAATCTGTGCCATTTGTCTTCTCTTCAGGCTCTGGTGTATGGAGTGT
AAGTACTACGTGGAATGATTACTTAGGAGGCTCCATACTTCATTTCCCCT
GCTATGTGTATGGCTGCATCTACTGGAAAATGATACACATCAACATGTTG
TACAAGCTCGACATCAACGCGATGGAGTTCTCCACCGTTGACCTCCCGCC
TCATTACAAAAAGCGAGATGTTATCATTTTGGAGGCAGGAGAAGGAAGGG
TTGGGGTGTTTAGTCTTGTTACGTTTAGCAAGGCTGTGTATTATGCTATT
CAGCAAAAGGAGGGCAAGATTGCCGATGACTGCCACACAGAAACTATAAT
CCACTTACCTGGTCATTATCATTTCATCATGGTTGGTGCAGCTGAAGGGT
ACATCTTCTTTGTAGCCTTACCAAAAGACCCCATGGTAAATGCAGCAGCA
GCAAGCTTCTCACTTCAGGTGAAGACATTGAAGATTGAGATGGTCTGTCG
GATGATGTTCGAGTCATGTTATCAACCATATTTCGGGTTCCCACCATCCA
TGTCGCCAAGAAGGATATGA
back to top

gene from alignment at Sh_005H13_contig-1:14065..15984-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_005H13_contig-1_g000020 ID=Sh_005H13_contig-1_g000020|Name=Sh_005H13_contig-1_g000020|organism=R570 Sugarcane cultivar|type=gene|length=1920bp|location=Sequence derived from alignment at Sh_005H13_contig-1:14065..15984- (R570 Sugarcane cultivar)
ATGGCGTCGCTGTTCCGTTCGATCCTCCGGCTATTCCAAGCGAAGGCGCC GGGGCCGGAGCTTCTGGATCTCAGCGACGATCTCCTCCGGGAGATCCTCC TGCGGATCGGCTTCCCCGCCGACGTCATCCGCGCCTCCGCCGCATGCGTC ACATTCCGCCGCCTCGTCGCCGAACCCTCCTTCTTCTGCCGTTACCGCTC CCTCCATCCTCCGCTACTCCTCGGCTTCCTCGAAACCAGAACCAAATTGT TCCAGCCGGCCGAGGCGCCCCACCCCAACGCTCCTGCCGCCCGCGCTCTC GCCCGCACCGCGAGCTTCTCCTCCGAGGATCGGCTCCCTCGCCTCCACAT AGTTTCGTACTGCACTGGCCCTGGGAGATCTGTGACCTCCGCGAAGGCCG TGTCCTCCTCAAGTGCAGACCTCTGGGATTTACATTCAGGGTCGCCTGCT GCTACCTCGCATTTCCGACGACCTACTCGCCTCCGTTCAGGTTCAGCGAT GTAACATTCCATGTTTCGAGGCCTTCCTTGTCCCTTCTTCTGCAGAAGAG GAGGATGAGAGGTCGTTCAGAGTGATCGGCATGGCCATGACGGGTTGCAT GACGAAGCTAGCGGTATTTGTCTTCTCCTCGAGCTCTGGGCGCTGGAGTC TCGGTACGTCTACAAATTTGGATACTCTTAATGTACCACCAGACATAAAG ATGCTGAAACAGCCCCATCTTTCTCATGGCTGTTTCTTCTGGAAAGTGGA GAAGAAGGACAAGTTGCTCAAGCTTGACATGAGCATAATGGAGCTCTCCA CATACGACCTCCCGCCTGGTCACCATGAGCGCTATACTGTCGTTGCAGAG GCAGGTGAAGGAAGACTTGCGTTGTTTAGCTGCCCACGCTCTTCTGAAGA AACATATGTGGATTATTACACCAGCATTATGCAAACCAAGAGCGACAGGG ACAAGGAGTGGCAGATGATAACCATAATCCCACTTCCCCCCAATCATCGG TATGAGATTTGTGGTGCAGCTGACGGATACATTTTCCTATTAGGATTTCC AAAATTCCCAGGACCGGGTCATGCAGTTTGTTTATCCCTCGAGGTTAAGA ATTTGAGGATTGAGAGGGTGTGTTCTGCAATGCGCCGAAGTGGTGTCCTG CACCCGTATTTCGGGTACCCACCACCCATGTCACCGAAAGTCATACCAAG CGATACCGGCTTCTGCCCCCCATACCCGACAACCTCGCCTCCGTCCACGT CCATCTGCAAAATTGTCAATCTTTCGAGGCCTTCTTTGCACCTATTGGAG AAGAGGAGGATAATACATCGTTCAGAGTGATCGGCAGGGCACATTGCCCG ATCAAATCTGTGCCATTTGTCTTCTCTTCAGGCTCTGGTGTATGGAGTGT AAGTACTACGTGGAATGATTACTTAGGAGGCTCCATACTTCATTTCCCCT GCTATGTGTATGGCTGCATCTACTGGAAAATGATACACATCAACATGTTG TACAAGCTCGACATCAACGCGATGGAGTTCTCCACCGTTGACCTCCCGCC TCATTACAAAAAGCGAGATGTTATCATTTTGGAGGCAGGAGAAGGAAGGG TTGGGGTGTTTAGTCTTGTTACGTTTAGCAAGGCTGTGTATTATGCTATT CAGCAAAAGGAGGGCAAGATTGCCGATGACTGCCACACAGAAACTATAAT CCACTTACCTGGTCATTATCATTTCATCATGGTTGGTGCAGCTGAAGGGT ACATCTTCTTTGTAGCCTTACCAAAAGACCCCATGGTAAATGCAGCAGCA GCAAGCTTCTCACTTCAGGTGAAGACATTGAAGATTGAGATGGTCTGTCG GATGATGTTCGAGTCATGTTATCAACCATATTTCGGGTTCCCACCATCCA TGTCGCCAAGAAGGATATGA
back to top