Sh_005M20_g000030

Overview
NameSh_005M20_g000030
Unique NameSh_005M20_g000030
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length7137
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_005M20contigSh_005M20:24408..31544
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
Notesimilar to H0818H01.1 protein
TypemRNA
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_005M20_t000030Sh_005M20_t000030R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_005M20_g000030 ID=Sh_005M20_g000030|Name=Sh_005M20_g000030|organism=R570 Sugarcane cultivar|type=gene|length=7137bp
ATGGCGAGCTCGCTGGCCCGCCTAGGAGCGGCGCTGCCGCGCGCGCGCCC
ACGCCCACGCTTCGCGGCCCGAGCCCTGCCACCGGGGCGGTGGGACGCCG
CCGCGCTCGGCGCCTCCCGCCGCGCCGCGCTGAACGGTAAGAGCATGCTA
CCCACACACCAATTTCGCTGTTACTGTTAGTGGTGAGGGCTGAGGGGACG
TGGGATTGGGTGGATCGTCGTGCAGTGCTTACTCATGAATCCTCTTGTGA
TCGAGCCGGATGCTTCGATCGGACCTAGGAGGTTCAGGATGTTGGTATTT
GTTCTTGGCGAGGGGAACCTATGTCACTTCTTACCTTTTATTCTGCGTGC
CTTTGATCTCACGAATTTTACTGCATTCTGTCTCGTTGGGGGATAATGCG
CGTGCAAGTGCAGCGTGATATTGAGAATTTGAGGTGTGAACTCAAATGAG
TAGCATTTTGGGCTGCCAAACTACCAGAAATGTTCTGTTAGGCCTGTGCT
TTTATGCAGTATAAGATCAGGTTATTAAGTACGAATTTGTACATCAGCTT
ACAGGTGCCAAGTCCATTCCGACATTAAAGTAGCCCCTACATCGGACTTG
AAGGACGGTGGCAAATCTGAAGCTTGGAGGATCAAGATGCTCTATGACGG
TGATTGCCCTCTCTGTATGCGTGAGGTATGTTGCGCTAGAACTCTACGAT
GCAGCTTCTGGAAGAACATAGCCTCATTTTCCAATAAGGCAATGATTAAT
GAGCAAGTTGAACTAATGGGCACATGTCACCGGTTGATGGCATTGCTGAT
TGTATAACAGGCAGTATGGTTAATTCATACTGCGTTCACTAGTTTTTTCT
CACCCGGTTGTGGAAACTGATCTTCTGCATCTATTTGGTATCCTAGGGGC
ACCATTCAATTACCTTTAATATTTTAAGTAATGATTGTCTGATTCCTCTT
TTATTAGTTCTTTGAGTTCCATTTCCAGCTAGCTGATCTTGATTCCTAAT
CAACAGCTGAGAGTAGGCAGCCATGAGGCTGTGACAAAAAAAGAGTACAA
ATTATTGTTGGAGTATATGTAGGCCCATGAGGCCATGTTGGAGTATATGT
AGGCCCATGAGGCCAAGGCCCATGTGGCCCATGTATGGAGACTATATAGC
TACCCTTCTAGGGTTAGCCAAGTAATGGATTCACTTTCTCCAACATGGTA
ATCAGAGCTTAGGGTTAGGTTCCTCTTCCCCTGCCTCCCAGCCGCCGCCA
CCCTGCTGGTGCCGCCCGCCGGCCCAGCCACCATGGCCGGCGGCCCTCCT
CTTCCCCCCTCTCTCTATTCCCACTTCCCCTCCTCTTCCTCTCCCACCTG
GGCCCAAATCCTGGCCGATGCAGCCGCTGCTGCCTCTCCCAGCGCCGCTG
CTGCAGCCCACCCGCCCAGACCCGGCGCGCCCCCTCTGGCCGCCCCTCTT
CCCGCCGGCCAGTACCTGGCCGCCGGCCAACCTCTTCCCGCCGGCCAGCA
CCTGGCCGCCGGCCACCCTCTCCCCGCCGGCCAACACCTGGCCGCCGGCC
ACCCCCTGCCTGCTGGCGGCTACCCTCTGGCCGGCGGGCAGCCCCTGCAG
CAGCGCCCCTCCTCCCCCTTCCCACCTGGGGCTGCGGCTCCTCCTCCTGA
TGCCGCCACTGCCCAAGCCCTTGCCGCCTCCTCTGATCTGGGCACGGTGG
GGGATGGAACCGAGGATGCAGCGCCGGCAGGGGTAGTTCAGCCACTCCTC
TCCACTGGCGACCCCGCTGGTGCCGCTACCGGTGCTGCTGCTCCTTCTCT
GGACCTTCTCGGTCTCGGTGGCTCTCATCCTTTGCGCGCCCCGGGGCCCG
ATTCCACTCTCGCTGCCGCCCTCGTGGCTGCCCGTGCTGCTGCCGCGGAA
GGCCAAGCTCGTGTGCGTGCGGCGGCTTTCGTGTGGGAGCGCGAGCGCGA
CGCGGCCGACACTTTGGCTCGCCAGATCGCCGAGGCGGAGCAGCTCCTTG
CTCCACCCGCCTCCCGGGACGTCGGTGCCACCTCTGCCTCGCCCAGACGT
CCCATCCACCACACCACCGTCCTCTGGCATGATCCGGCGGACCCGCTCGT
GGCCCAGCTCCACTACCAGGCCGGGGGGGTTCAGAACATTCGCCTTCTCG
TCCCGGTCGTCCTCGAGCCGGAGTCGCCCTCCTACGCCCGCTGGAGAGAT
CTGGTGGTTCTCACCCTTCGCCGCTACGCCCTCGACGACCACGTCCTCGT
CGACGTCTCGGTCGCCGTCCAGACGCCGTCGTGGCTCCGTCTCGACAGCA
TCGTCCTCTCCTGGATCTTGGGGACGATCTCTCTGGACCTCCACGACCTC
GTCCGCACCTCCCCTGACGCGCGTCGGGCATGGCTTGCCCTTGAGGGCCA
GTTCCTGGGCAACGCCGAGGCCCGGGCTCTGCGCCTCGACGCGAGCTTCC
GCACCTTCGTCCAGGGTGACCTCTCCGTCGGGGAGTTCTGTCGTCGGATG
AAGGCCATGGCTGACTCACTGGGGGACCTCGGGTGGCCCGTGGAGGATCG
CATCTTGGTCCTCAACGTCCTCCGGGGGCTCAGCGACCGCTACGCCCACC
TGCGGACGTGGATCACCCGTCAGAGGCCCTTCCCCACCTTCCTGGAGGTC
CGTGACGATCTTGTCATGGAGGAGCTCACGCAGGGCCTCCAGCCGGGTTA
TACTGCTTCCCCGGGGGCCTCCTCGACGGCGCTGGCCGCTACCTCGCCGC
GCCCGTCTGGTTCACGTCCGTCTGCTCCACCGCCGTCGTCTCTTCTGGGT
CCCCCTCCCTCCGGGCCGAGCGGAGGTGGGGGGGGTCGTGGCGGACGTCG
TCGCCGCGGAGGGGGTCGCGGGGGTGGCCGAGGCGCACCTCCACAAGCCC
CGGCACCTGGTGGCCCACAGGGGGGGCACCATGGCCCTCCTTCCAGCACC
CGTGGTCTGGGCGCATCTCCATGTGGCCCTACCACGCCACCGGGACCGTC
TCGCGTCCACCGGTGGCCATGCTCACCGGCACACCTCCCGCTGGTCCTCT
CGGCGGCTTCCCTGCTCCACCGCCGGCTGCTTCGTGGGTTCCTCCTTCCG
GACCTTCCGGACCTCCACCGGGGGTCGCCGGATGGGACCAGACGGCCCTG
GCTCACTCGTTCTCCACCTTGGGTCTGACACCTCCGGTTGGACCCGAGTG
GATCGCCGATTCGGGGGCTACCTACCACACCACTCCTGACCCCGGTATAC
TTTCGTCGATTCACTCTCCCTCTTCCTCTCTTCCTTCGTCCATTATGGTC
GCAAATGGTTCTTGTATTCCAGTCTCATCTGTGGGTACCGCCGGTGCTCA
TGGCTCCTTTCGCCTTCCTGATGTTCTTGTGGCTCCTTCCATGGTTCATA
ACCTTCTTTCTATTCGTCGTTTTACAGCTGACAATTCTTGTTCTGTGGAA
TTTGACTCTTCTGGTCTTACTGTAAAGGATTTGGCTTCCCGGCGACCTCT
GCTCCGATGTGACAGCACCGGGCCCCTTTACACCCTTCGCTTCCCGGCGG
CGCATTCGTCTTCTTCGCCGTCCCTTTTGTCAGCTGCCTTCGCCGCTTCT
ACTTCCTCCACTACTTGGCACCGGCGCCTCGGCCATCCTGGACGTGATGT
CCTGATACAGCTCAGTCGTAGCTCTGGTCTTCCATGTACTCGAGCTCATG
ATGAGCAACTGTGTCATGCGTGCCAATTGGGCCGTCATGTTCGTCTTCCT
TTTTCTCGTTCTTCTTCACATGCGGCCCGCATTTTTGATCTTGTACATTG
CGACCTATGGACATCTCCTGTTATCAGTATTTCTGGTTATAAGTACTATC
TTGTGGTTGTTGATGATTTTTCGCATTACTCATGGACCTTTCCTCTACGT
GCGAAGTCGGATACTTTTACCACGCTCCTTCACTTCTTTACTTGGGTGTC
TACTCAGTTCGGTCTCACCATCAAGGCCGTCCAGTGTGACAACGGTCGCG
AGTTTGATAACTCCACCTCCCGAGCTTTCTTCCTCTCTCACGGTGTTCAG
TTGCGCATGTCTTGCCCATACACCTCCTCGCAGAATGGCAAGGCAGAGCG
GATGATTCGCACCACCAACGACACCGTGAGGACTCTTCTGTTTCAGGCCT
CTCTTCCTGCCCGCTTCTGGGCTGAGGGCCTGCACACCTCCACATACCTT
CTTAACCGCCTTCCTTCTGCTGCCTGTCCCGCTCCCACCCCTCACCACGC
CCTCTTCGGTACCCCGCCTCGGTACGATCACCTCCGCGTGTTTGGGTGTG
CTTGTTACCCCAACACTGCCGCCACCTCTTCTCACAAGCTGGACCCTCGA
TCCACGCTCTGTGTCTTCCTCGGTTACTCCCCGGATCACAAGGGGTACCG
ATGCTTCGACCTTACCTCACGACGTGTTCTCATCTCGCGCCATGTGGTGT
TCGATGAGTCCGTCTTTCCCTTTTCCGGCACCTCTACTTCTCCGGTCCCC
GACCCACCCACCATTTTTCCCACTGATCCGGTGGTCCAGCCACCTTTCTT
GTGGTCTCCTGCAGGTACCGCTTCACCGCGCTCCGCGCCGGCCCCCGGTC
CCGGCAACCCTGCGAGTTCGGGCCCCTCGTCCTCCGGTGCGGCCCCGTCT
CCTTCCGTTGGTGCCGACCCGGGGCCTCCGTCCCCCGTTTCGGCCCCAGG
GGGGTCGTGCCGGTTGCCGACGCCGGATCCTGCCTCGGCACCCGCCCCGG
CGCCTCCGTCGAGGTTCGCCGCGCCGGTACGGGTTTACCAGCGCAGGCTG
CGGCCACCGCCGCAGCCTGTCCCTTCTCCACCAGGGACACCGACACCACC
GCCACTGTCTCCGCCGATCCGTGGCACCCCGCAGGTCTACCACCCGCCGC
TGCTTCACCGACACCCGCGGCATGTTCACCCGATGGTGACACGACACGCG
GCGGGCACCCTGCCGCCTCGTGTCCTCGAGGCTTCGACCGGCGACGTGGT
GGTCTCTCCGGTACCCTCCTCCGTCCGCGACGCACTGCTGGACCCTCACT
GGCGCCGCGCGATGGAAGAGGAGTACACCGCGCTGCTCGCCAACCAGACA
TGGGAGTTGGTGCCCCGGCCGCCGGGCGCCAATGTCGTCACCGGCAAGTG
GATTTGGACTCACAAGCGCCGAGCGGACGGCTCTCTCGAGCGCTACAAGG
CTCGGTGGGTCCTCCGGGGTTTCACTCAGCGCCCCGGTGTCGACTACGAT
GAGACCTTCAGCCCGGTGGTCAAGCCGGCCACAGTCCGTACAGTACTATC
GCTGGCACTTGCTCGGTCTTGGCCCGTCCACCAGCTGGATGTCAAGAACG
CCTTCCTCCACGGCCTTCTCACTGAGACGGTGTACTGCAGTCAGCCGGCG
GGGTTCGTCGACACCACCCGTCCTGATATGGTCTGCCGGCTCAACAGGTC
CCTCTACGGCCTCAAGCAGGCACCTCGGGCGTGGAACCACCGGTTCGCTA
CTTTCTTGCTGACCCTGGGATTCGTGGAGGCCAAGTCTGATACGTCCCTG
TTCGTCTACCACCGTGGAGCCGACACTGCATACTTGCTGCTCTATGTTGA
TGACATTGTCCTCACCGCCTCCAGCGAGCCACTTCTCCGGCGGATCATTG
CAGCTCTCCAGCAGGAGTTTGCGATGAAGGACCTGGGTGAGCTCCACCAC
TTCCTCGGTGTCACTGTTGAGCACCGTCCTGCTGGGCTCCTTCTTCATCA
GCGGCAGTACACTCGGGATATCCTGGAGCGGGCTGGGATGTCTGACTGCA
AGCCCTGCTCCACCCCAGTCGACACTCAGGGCAAGCTGTCGGAGGCTGAG
GGACCTCCGGTGGCCGACCCCACTGCGTACAGGAGTCTTGCCGGGGCTCT
TCAGTACCTCACCTTCACCCGGCCGGACATCACATATGCAGTTCAGCAGG
TCTGCCTCCACATGCATGATCCCCGGGAGCCTCACCTCACGGCTCTCAAG
CGTCTCCTCCGCTACCTCCGGGGCACACTCGACTACGGCCTCCTCCTACA
CCGGGCCTCCTCCACCGACCTCGTTGTCTACACCGACGCTGACTGGGCCG
GGTGCCCGGATACTCGCCGCTCCACCTCCGGCTACGCCGTCTTCCTGGGC
GGCAACCTGGTGTCTTGGTCGTCCAAGCGCCAGCCGGTGGTCTCCCGGTC
CAGTGCCGAGGCGGAGTACCGCGCCATGGCTAACGGGGCTTAGTGCCAGA
TAAACTGTTGGATAGTTAAATCAGACTAGGCTGACTGTCTGAACATTTTT
GCAGTAAATGAAGGGAATGACCAATTGAGTTACATGTTATTAATGAATGA
CTAGATGTTTCTTTTACATAATACTGCAATACATCTGTTTTCCTTGTGTT
CACTTAACTCTGTGTAACTGTATTAATTCATAGATGAGTTTGTACAAGCA
AAAATTAAGACTGTTCTCTTCTAGTGCCTAGCAAGCTTAGATACTAATGT
TTTCTTGACAGGATTCAGGACACCGTTACATGCATAGCTTATCGTCACTA
GACTGCTACACTAGTGTTGCTAACCACAGTAAATCATCTTCTAAAGAACT
TGATGTAGAATATCCTGATCTGTCAACAAAGTTAATTTGGCCAAGCTACA
AAAGAATCATTCCAAAATGTAGTGCCAAACCTAACAAAGTATGTTTTCGC
AAAAAAAAAAAAAGGAAGTATGAGTGTGGCACCAAGACAAATAAAATGCC
TAGTCAGAATTTAATTCCTTTTAGTCTAAGCATCGGGTATGTTTCATGCT
AATATTTATTATGTTTTCATTGCAGGCATTTAGAAAACTGTACGAGGAAG
TAGGACTTGGATGGGTTTATGCTGTTACTAAGTATGAGCCTGTAAGTCGC
TACTTACAGAGAGCAAAACATAGGCTCAGCTTGGTCCATTCACTTCATAG
GCTCACCATTCAGCCGCGTGCTTTTTATATAAGCAGAACATCTTACAGAT
GAGATTAAACATAAGTTTTATCTTCTTAATGACACCTGTACCTCTTTATT
CATCTTCTAATACTCTGCAGGTAGCTACCATGGCAAATGCAGTATATGGC
GTGTGGGCGAAATACCGTATGCAAATTACAGGTATAG
back to top

gene from alignment at Sh_005M20:24408..31544+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_005M20_g000030 ID=Sh_005M20_g000030|Name=Sh_005M20_g000030|organism=R570 Sugarcane cultivar|type=gene|length=7137bp|location=Sequence derived from alignment at Sh_005M20:24408..31544+ (R570 Sugarcane cultivar)
ATGGCGAGCTCGCTGGCCCGCCTAGGAGCGGCGCTGCCGCGCGCGCGCCC ACGCCCACGCTTCGCGGCCCGAGCCCTGCCACCGGGGCGGTGGGACGCCG CCGCGCTCGGCGCCTCCCGCCGCGCCGCGCTGAACGGTAAGAGCATGCTA CCCACACACCAATTTCGCTGTTACTGTTAGTGGTGAGGGCTGAGGGGACG TGGGATTGGGTGGATCGTCGTGCAGTGCTTACTCATGAATCCTCTTGTGA TCGAGCCGGATGCTTCGATCGGACCTAGGAGGTTCAGGATGTTGGTATTT GTTCTTGGCGAGGGGAACCTATGTCACTTCTTACCTTTTATTCTGCGTGC CTTTGATCTCACGAATTTTACTGCATTCTGTCTCGTTGGGGGATAATGCG CGTGCAAGTGCAGCGTGATATTGAGAATTTGAGGTGTGAACTCAAATGAG TAGCATTTTGGGCTGCCAAACTACCAGAAATGTTCTGTTAGGCCTGTGCT TTTATGCAGTATAAGATCAGGTTATTAAGTACGAATTTGTACATCAGCTT ACAGGTGCCAAGTCCATTCCGACATTAAAGTAGCCCCTACATCGGACTTG AAGGACGGTGGCAAATCTGAAGCTTGGAGGATCAAGATGCTCTATGACGG TGATTGCCCTCTCTGTATGCGTGAGGTATGTTGCGCTAGAACTCTACGAT GCAGCTTCTGGAAGAACATAGCCTCATTTTCCAATAAGGCAATGATTAAT GAGCAAGTTGAACTAATGGGCACATGTCACCGGTTGATGGCATTGCTGAT TGTATAACAGGCAGTATGGTTAATTCATACTGCGTTCACTAGTTTTTTCT CACCCGGTTGTGGAAACTGATCTTCTGCATCTATTTGGTATCCTAGGGGC ACCATTCAATTACCTTTAATATTTTAAGTAATGATTGTCTGATTCCTCTT TTATTAGTTCTTTGAGTTCCATTTCCAGCTAGCTGATCTTGATTCCTAAT CAACAGCTGAGAGTAGGCAGCCATGAGGCTGTGACAAAAAAAGAGTACAA ATTATTGTTGGAGTATATGTAGGCCCATGAGGCCATGTTGGAGTATATGT AGGCCCATGAGGCCAAGGCCCATGTGGCCCATGTATGGAGACTATATAGC TACCCTTCTAGGGTTAGCCAAGTAATGGATTCACTTTCTCCAACATGGTA ATCAGAGCTTAGGGTTAGGTTCCTCTTCCCCTGCCTCCCAGCCGCCGCCA CCCTGCTGGTGCCGCCCGCCGGCCCAGCCACCATGGCCGGCGGCCCTCCT CTTCCCCCCTCTCTCTATTCCCACTTCCCCTCCTCTTCCTCTCCCACCTG GGCCCAAATCCTGGCCGATGCAGCCGCTGCTGCCTCTCCCAGCGCCGCTG CTGCAGCCCACCCGCCCAGACCCGGCGCGCCCCCTCTGGCCGCCCCTCTT CCCGCCGGCCAGTACCTGGCCGCCGGCCAACCTCTTCCCGCCGGCCAGCA CCTGGCCGCCGGCCACCCTCTCCCCGCCGGCCAACACCTGGCCGCCGGCC ACCCCCTGCCTGCTGGCGGCTACCCTCTGGCCGGCGGGCAGCCCCTGCAG CAGCGCCCCTCCTCCCCCTTCCCACCTGGGGCTGCGGCTCCTCCTCCTGA TGCCGCCACTGCCCAAGCCCTTGCCGCCTCCTCTGATCTGGGCACGGTGG GGGATGGAACCGAGGATGCAGCGCCGGCAGGGGTAGTTCAGCCACTCCTC TCCACTGGCGACCCCGCTGGTGCCGCTACCGGTGCTGCTGCTCCTTCTCT GGACCTTCTCGGTCTCGGTGGCTCTCATCCTTTGCGCGCCCCGGGGCCCG ATTCCACTCTCGCTGCCGCCCTCGTGGCTGCCCGTGCTGCTGCCGCGGAA GGCCAAGCTCGTGTGCGTGCGGCGGCTTTCGTGTGGGAGCGCGAGCGCGA CGCGGCCGACACTTTGGCTCGCCAGATCGCCGAGGCGGAGCAGCTCCTTG CTCCACCCGCCTCCCGGGACGTCGGTGCCACCTCTGCCTCGCCCAGACGT CCCATCCACCACACCACCGTCCTCTGGCATGATCCGGCGGACCCGCTCGT GGCCCAGCTCCACTACCAGGCCGGGGGGGTTCAGAACATTCGCCTTCTCG TCCCGGTCGTCCTCGAGCCGGAGTCGCCCTCCTACGCCCGCTGGAGAGAT CTGGTGGTTCTCACCCTTCGCCGCTACGCCCTCGACGACCACGTCCTCGT CGACGTCTCGGTCGCCGTCCAGACGCCGTCGTGGCTCCGTCTCGACAGCA TCGTCCTCTCCTGGATCTTGGGGACGATCTCTCTGGACCTCCACGACCTC GTCCGCACCTCCCCTGACGCGCGTCGGGCATGGCTTGCCCTTGAGGGCCA GTTCCTGGGCAACGCCGAGGCCCGGGCTCTGCGCCTCGACGCGAGCTTCC GCACCTTCGTCCAGGGTGACCTCTCCGTCGGGGAGTTCTGTCGTCGGATG AAGGCCATGGCTGACTCACTGGGGGACCTCGGGTGGCCCGTGGAGGATCG CATCTTGGTCCTCAACGTCCTCCGGGGGCTCAGCGACCGCTACGCCCACC TGCGGACGTGGATCACCCGTCAGAGGCCCTTCCCCACCTTCCTGGAGGTC CGTGACGATCTTGTCATGGAGGAGCTCACGCAGGGCCTCCAGCCGGGTTA TACTGCTTCCCCGGGGGCCTCCTCGACGGCGCTGGCCGCTACCTCGCCGC GCCCGTCTGGTTCACGTCCGTCTGCTCCACCGCCGTCGTCTCTTCTGGGT CCCCCTCCCTCCGGGCCGAGCGGAGGTGGGGGGGGTCGTGGCGGACGTCG TCGCCGCGGAGGGGGTCGCGGGGGTGGCCGAGGCGCACCTCCACAAGCCC CGGCACCTGGTGGCCCACAGGGGGGGCACCATGGCCCTCCTTCCAGCACC CGTGGTCTGGGCGCATCTCCATGTGGCCCTACCACGCCACCGGGACCGTC TCGCGTCCACCGGTGGCCATGCTCACCGGCACACCTCCCGCTGGTCCTCT CGGCGGCTTCCCTGCTCCACCGCCGGCTGCTTCGTGGGTTCCTCCTTCCG GACCTTCCGGACCTCCACCGGGGGTCGCCGGATGGGACCAGACGGCCCTG GCTCACTCGTTCTCCACCTTGGGTCTGACACCTCCGGTTGGACCCGAGTG GATCGCCGATTCGGGGGCTACCTACCACACCACTCCTGACCCCGGTATAC TTTCGTCGATTCACTCTCCCTCTTCCTCTCTTCCTTCGTCCATTATGGTC GCAAATGGTTCTTGTATTCCAGTCTCATCTGTGGGTACCGCCGGTGCTCA TGGCTCCTTTCGCCTTCCTGATGTTCTTGTGGCTCCTTCCATGGTTCATA ACCTTCTTTCTATTCGTCGTTTTACAGCTGACAATTCTTGTTCTGTGGAA TTTGACTCTTCTGGTCTTACTGTAAAGGATTTGGCTTCCCGGCGACCTCT GCTCCGATGTGACAGCACCGGGCCCCTTTACACCCTTCGCTTCCCGGCGG CGCATTCGTCTTCTTCGCCGTCCCTTTTGTCAGCTGCCTTCGCCGCTTCT ACTTCCTCCACTACTTGGCACCGGCGCCTCGGCCATCCTGGACGTGATGT CCTGATACAGCTCAGTCGTAGCTCTGGTCTTCCATGTACTCGAGCTCATG ATGAGCAACTGTGTCATGCGTGCCAATTGGGCCGTCATGTTCGTCTTCCT TTTTCTCGTTCTTCTTCACATGCGGCCCGCATTTTTGATCTTGTACATTG CGACCTATGGACATCTCCTGTTATCAGTATTTCTGGTTATAAGTACTATC TTGTGGTTGTTGATGATTTTTCGCATTACTCATGGACCTTTCCTCTACGT GCGAAGTCGGATACTTTTACCACGCTCCTTCACTTCTTTACTTGGGTGTC TACTCAGTTCGGTCTCACCATCAAGGCCGTCCAGTGTGACAACGGTCGCG AGTTTGATAACTCCACCTCCCGAGCTTTCTTCCTCTCTCACGGTGTTCAG TTGCGCATGTCTTGCCCATACACCTCCTCGCAGAATGGCAAGGCAGAGCG GATGATTCGCACCACCAACGACACCGTGAGGACTCTTCTGTTTCAGGCCT CTCTTCCTGCCCGCTTCTGGGCTGAGGGCCTGCACACCTCCACATACCTT CTTAACCGCCTTCCTTCTGCTGCCTGTCCCGCTCCCACCCCTCACCACGC CCTCTTCGGTACCCCGCCTCGGTACGATCACCTCCGCGTGTTTGGGTGTG CTTGTTACCCCAACACTGCCGCCACCTCTTCTCACAAGCTGGACCCTCGA TCCACGCTCTGTGTCTTCCTCGGTTACTCCCCGGATCACAAGGGGTACCG ATGCTTCGACCTTACCTCACGACGTGTTCTCATCTCGCGCCATGTGGTGT TCGATGAGTCCGTCTTTCCCTTTTCCGGCACCTCTACTTCTCCGGTCCCC GACCCACCCACCATTTTTCCCACTGATCCGGTGGTCCAGCCACCTTTCTT GTGGTCTCCTGCAGGTACCGCTTCACCGCGCTCCGCGCCGGCCCCCGGTC CCGGCAACCCTGCGAGTTCGGGCCCCTCGTCCTCCGGTGCGGCCCCGTCT CCTTCCGTTGGTGCCGACCCGGGGCCTCCGTCCCCCGTTTCGGCCCCAGG GGGGTCGTGCCGGTTGCCGACGCCGGATCCTGCCTCGGCACCCGCCCCGG CGCCTCCGTCGAGGTTCGCCGCGCCGGTACGGGTTTACCAGCGCAGGCTG CGGCCACCGCCGCAGCCTGTCCCTTCTCCACCAGGGACACCGACACCACC GCCACTGTCTCCGCCGATCCGTGGCACCCCGCAGGTCTACCACCCGCCGC TGCTTCACCGACACCCGCGGCATGTTCACCCGATGGTGACACGACACGCG GCGGGCACCCTGCCGCCTCGTGTCCTCGAGGCTTCGACCGGCGACGTGGT GGTCTCTCCGGTACCCTCCTCCGTCCGCGACGCACTGCTGGACCCTCACT GGCGCCGCGCGATGGAAGAGGAGTACACCGCGCTGCTCGCCAACCAGACA TGGGAGTTGGTGCCCCGGCCGCCGGGCGCCAATGTCGTCACCGGCAAGTG GATTTGGACTCACAAGCGCCGAGCGGACGGCTCTCTCGAGCGCTACAAGG CTCGGTGGGTCCTCCGGGGTTTCACTCAGCGCCCCGGTGTCGACTACGAT GAGACCTTCAGCCCGGTGGTCAAGCCGGCCACAGTCCGTACAGTACTATC GCTGGCACTTGCTCGGTCTTGGCCCGTCCACCAGCTGGATGTCAAGAACG CCTTCCTCCACGGCCTTCTCACTGAGACGGTGTACTGCAGTCAGCCGGCG GGGTTCGTCGACACCACCCGTCCTGATATGGTCTGCCGGCTCAACAGGTC CCTCTACGGCCTCAAGCAGGCACCTCGGGCGTGGAACCACCGGTTCGCTA CTTTCTTGCTGACCCTGGGATTCGTGGAGGCCAAGTCTGATACGTCCCTG TTCGTCTACCACCGTGGAGCCGACACTGCATACTTGCTGCTCTATGTTGA TGACATTGTCCTCACCGCCTCCAGCGAGCCACTTCTCCGGCGGATCATTG CAGCTCTCCAGCAGGAGTTTGCGATGAAGGACCTGGGTGAGCTCCACCAC TTCCTCGGTGTCACTGTTGAGCACCGTCCTGCTGGGCTCCTTCTTCATCA GCGGCAGTACACTCGGGATATCCTGGAGCGGGCTGGGATGTCTGACTGCA AGCCCTGCTCCACCCCAGTCGACACTCAGGGCAAGCTGTCGGAGGCTGAG GGACCTCCGGTGGCCGACCCCACTGCGTACAGGAGTCTTGCCGGGGCTCT TCAGTACCTCACCTTCACCCGGCCGGACATCACATATGCAGTTCAGCAGG TCTGCCTCCACATGCATGATCCCCGGGAGCCTCACCTCACGGCTCTCAAG CGTCTCCTCCGCTACCTCCGGGGCACACTCGACTACGGCCTCCTCCTACA CCGGGCCTCCTCCACCGACCTCGTTGTCTACACCGACGCTGACTGGGCCG GGTGCCCGGATACTCGCCGCTCCACCTCCGGCTACGCCGTCTTCCTGGGC GGCAACCTGGTGTCTTGGTCGTCCAAGCGCCAGCCGGTGGTCTCCCGGTC CAGTGCCGAGGCGGAGTACCGCGCCATGGCTAACGGGGCTTAGTGCCAGA TAAACTGTTGGATAGTTAAATCAGACTAGGCTGACTGTCTGAACATTTTT GCAGTAAATGAAGGGAATGACCAATTGAGTTACATGTTATTAATGAATGA CTAGATGTTTCTTTTACATAATACTGCAATACATCTGTTTTCCTTGTGTT CACTTAACTCTGTGTAACTGTATTAATTCATAGATGAGTTTGTACAAGCA AAAATTAAGACTGTTCTCTTCTAGTGCCTAGCAAGCTTAGATACTAATGT TTTCTTGACAGGATTCAGGACACCGTTACATGCATAGCTTATCGTCACTA GACTGCTACACTAGTGTTGCTAACCACAGTAAATCATCTTCTAAAGAACT TGATGTAGAATATCCTGATCTGTCAACAAAGTTAATTTGGCCAAGCTACA AAAGAATCATTCCAAAATGTAGTGCCAAACCTAACAAAGTATGTTTTCGC AAAAAAAAAAAAAGGAAGTATGAGTGTGGCACCAAGACAAATAAAATGCC TAGTCAGAATTTAATTCCTTTTAGTCTAAGCATCGGGTATGTTTCATGCT AATATTTATTATGTTTTCATTGCAGGCATTTAGAAAACTGTACGAGGAAG TAGGACTTGGATGGGTTTATGCTGTTACTAAGTATGAGCCTGTAAGTCGC TACTTACAGAGAGCAAAACATAGGCTCAGCTTGGTCCATTCACTTCATAG GCTCACCATTCAGCCGCGTGCTTTTTATATAAGCAGAACATCTTACAGAT GAGATTAAACATAAGTTTTATCTTCTTAATGACACCTGTACCTCTTTATT CATCTTCTAATACTCTGCAGGTAGCTACCATGGCAAATGCAGTATATGGC GTGTGGGCGAAATACCGTATGCAAATTACAGGTATAG
back to top