Sh_005O03_contig-1_g000010

Overview
NameSh_005O03_contig-1_g000010
Unique NameSh_005O03_contig-1_g000010
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length3949
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_005O03_contig-1contigSh_005O03_contig-1:26931..30879
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
NoteConserved hypothetical protein
TypemRNA
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_005O03_contig-1_t000010Sh_005O03_contig-1_t000010R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_005O03_contig-1_g000010 ID=Sh_005O03_contig-1_g000010|Name=Sh_005O03_contig-1_g000010|organism=R570 Sugarcane cultivar|type=gene|length=3949bp
TTTATCGCCGGCTGCTAGGGTTTTATAGTTGGCGCCGCGACCTGAGCAGA
ACCGCCTCCATCCCCGACGCCCCCTCATCGCGTGGCCGATCCTTAGCATC
GCCGCCCTCCCCGTCCTCTCCTCCCGTTCCCTGCGGTATCCCTGACTCTC
ACGCCGCCGCCTTCCAACGAGCCGACGTGCCGAACGGAGGGAGATCCGTC
GTCCCCTGTCCTTCTCTCGGTAAGGAAGCCCCGATCAGACCTTCGTTTGT
TCCAATCCATGTTCGAGGCGAGGCTTCGATTTTTTATTGCGGGGAAGGGG
CTTAACTAGCCGTCCTATTAGTGATGATGCGTAATTTATGACACGCGCTC
CACCACGGGGATTTGTGATACCTGATGAATTTGAATTGATTGAGGGAGCA
TATGCAGCGGGTGGTTACCCATCCCACATGTGCCTTGTTGAGCTTGTTTC
GTGGTTAATAGGATTATTAGGATGCCATGCGCTCCTAATTCGTTATAGAT
TGTGTGCAGAGTACTATCTCCATGCCATGCTGCATTTGTTTACCTGCTTG
TAAGTTAAAATCATTAGCACTGGTTTGACTGCACTTTGTTGAAGAATTAT
GAGTTACATGACCTTGCAAATTGAACAAAGGGACTGTGTTGGTTCAAATC
TCCTTTTTTGGTTACATATTCCCAGGGCTTAAGCTGGTCTGTCCACAGAT
TTTTAAACAATTAAGAGTCCGGTAGCCTTATAAGAATTGAAAGCAAGACA
AGGTACTGCATTTGTTCACATGTCCTATGTTACACATTCCAAATTGAAGA
AAGTGACTGTTTGTTCAAATCCCCTTCCTTTGTTACATATTCTCAGTGTT
TCTGTTGTTCTATCTGCTCATTGTTGAACAATTAAGGGTTCTGTAGCCTT
AAGTTTTGAAAGAAAGGTGCTGCATTCGTTCATGTTCTATGTTATGTATG
TATTACAATGAGGCACAACAGGGTTTGTGCACTCATTGTTGAACATTTAC
AAGTTCTGTAGCCTTGCAAACTAGAAAGGGGGCTGCATTTGATAAAGTGT
CCTAGGTTTCATATTCTGATGGCAGCAAGTGGGCTTAATGGCCATGATGG
TGTACCTTAATTATTAATTCTTAATATACAGAATACTAGTAGCATTTATG
CTGCTTTAGCTACCAAGTTTGCCTTTGCATGTATTTGGTCCTCGCATGCA
ACTTGTATTACCACTTTATGAACTTAGATAGCAGATGGCATGCTAGAGAC
TAAACTTCACATATTTTCAACTGGGTGATGGAACTTAGCTTCTTATTGTA
TGTTTGTTCATTGTTTGGTCGCACTGATTACTATGTATAATTGTTGTATA
TATTGTACTTCGAAAGATGCTGTTTATCAATTTGGAACTAATTTGCTAAG
TATCTGGCTAATCGACTTGTTAATTTCTGCAGGCCGTATCATTTTATCTT
GACTCAGGAACTTTGTTAACAATTTGAAATCATTGACATATGGAGTCCCA
GAAGAGTTGTCTTTTGATCACTTACTCCCAGGAGATTGTAAATGGAGTTC
CTTTGTATGTTTCATCAAACTGCCTGCCTGTAAAAGCTTTGAAATATGAA
CCTGCTGGTCATTCGTTCCATGCTGCGGCAATGAAGCTTCTTGGTCTTGG
GCAGCATGAAGACATTGAAACTGATGATCATAGTGTCTCATCGGATGACA
AAAGCCAAGATTTTAATACTGCTTCTGACACCTTTAGCAGCAAAGGGAAG
AAGAAGTCATCTGGCAGTCAACAGCAGGATCACTATGCATTGCTTGGGTT
GGGACACTTGAGGTTCTTGGCCACTGAAGATCAGATTCGGAAAAGTTACC
GTGACATGGCTCTCAAACATCATCCAGATAAGCAGGCTTCCTTGATTCTT
GCAGAGACAACAGAGGAGGCAAAACAAGCAAAAAAGGATGAGATAGAGAG
CCATTTCAAGGCCATCCAGGAGGCCTATGAAGTCCTCATTGACCCTACAA
AGAGGAGGATTTATGACTCTACAGATGAGTTTGATGATGATGTCCCAACA
GACTGTGCCCCACAAGACTTCTTCAAGGTTTTCGGCCCAGCCTTCATGAG
AAATGGACGCTGGTCTGTTACCCAGCCTATTCCTTCTCTAGGAGATGATA
CTACTACTGTAGAGGAGGTTGATAAGTTCTACAATTTCTGGTACAACTTC
AAGAGTTGGAGGGAATTTCCAGATGATGATGAGTATGACTTGGAGCAAGC
TGAATCTCGTGAACATAAGAGATGGATGGAGCGGCAGAACGCAAAGCTAC
AAGAGAAGGCCAAAAAGGCGGAATATGCGCGAGTACGCACTCTTGTGGAC
AATGCTTATAAGAAAGACCCAAGGATCCAGAGGAGGAAAGAGGAGGAGAA
AGCTGAGAAACAGAGAAGAAAGGAGGCGAAGTATTTGGCAAAGAAATTGC
AAGAAGAGGAAGCAGCAAGAGCTGCTGAAGAGGAAAGGATAATGAAAGAA
GAAGAGTCTAAGAAAGCTGCAGAAGCTGCTCAGCATCAGAAGAAGCTAAA
GGAGAAAGAGAAGAAGCTGCTCCGCAAAGAGAAAACTCGTCTGCGCACTC
TTGCAGCACCTGTGGTTGCAGATAGCCACTTTGGTATGTCAGAGGAAGAT
GTTGAATCAACATGTGCTAAACTTGATATGGAACAGCTGAAGAAGCTCTG
TGATGGAATGGATGGCAAGGATGCAGCTGAAAAGGCCAGGTTGATGAGCA
ATGCACTTCGCAATGGAAGTTCCTCAAAGGAAGCGAAGAAAATTGAAGCC
AATGGTGTGGAGTGTTCTGCTCCAAAATCCAACTCTACAGGAGGTAGAGC
GACAGAAGGCAGTAGCAGCATATTGAAGAGCTATGAAAAAAAAGAGAGAC
CATGGAGAAAGGAAGAGGTTGAGATGCTTAGGAAAGCAATGCAAAAGTAT
CCCAAGGGAACTTCGAGAAGATGGGAGGTTGTTTCAGAATTTATTGGGAC
TAACAGATCGGTTGAGGAAATTCTCAAGGCCACTAAGAGTGTTCTTCTGC
AGAAGCCAGACTCATCGAAAGCTTTCGACTCTTTCCTTGAGAAGCGCAAA
CCGGCCCAATCTATTGCTTCACCTCTCTCGACCCGAGATGAAATTAGTTC
CTCAACTGAGGGAGCTGGGACTGCATCGTCAAAGGCCGCGTCACAACCTG
CGAGTAGCCAGGCAGCCAATGGGAAAGCTGCTGCTGATCCTTTCCCAGAT
GGAGCACCATCTGTGGCAGATCCAGATGCCTGGACAGAGGCTCAGGTCCT
GGCTCTAGTCCAAGCTTTGAAGGCTTTTCCCAAGGATGCAATCCAAAGAT
GGGAGCGTGTAGCTGCTGCTGTCCCAGGTAAAACTTTTGTCCAGTGCAAG
AAAAAGGTTGCAGCAATGAGAGAGAATTTCCGGAGCAAGAAAACTGGGGA
GTAGACTGAGGCATTGCCTCACTAGAAGTACATTTTGCAGGGAAGAGAAA
TCTCTGATGGCAATATTTTTATCCCTCAAAAAAAAAAGGATGGCAATATC
TATAGATTGGATCTTGGCTGGTGAGGTATTACTTGGCGAATCTCTCATGC
CTCCAGTGGTGAGGATAATTTTTGTTACGGAGCTATGATAACTCATTTAT
TGTGCCAGGCCACCAGGGTGGTTTTACTTTGGTCAGCTGTAGGAGGATGC
CATTGAAGCTCATCTACTGTTGATGGACTGATGATTGGCATTTTGTAGCA
GTGGTTTGTGTTGACTTTGTTTCGTCTGGCTCCTGGGGTTGTCTATGCGT
TGCTGGAATTGGTGCCCTGGTTCGGTAAAATGTAGAGAACCATATATGTT
TTTATTCATTATTAATAACTATAAGATAGGAATATATGTTACATCGTGAG
ACCTGTTATTGAAGTAAGCATTATTTTTCCTGGCCACGCACTTTGTAGT
back to top

gene from alignment at Sh_005O03_contig-1:26931..30879+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_005O03_contig-1_g000010 ID=Sh_005O03_contig-1_g000010|Name=Sh_005O03_contig-1_g000010|organism=R570 Sugarcane cultivar|type=gene|length=3949bp|location=Sequence derived from alignment at Sh_005O03_contig-1:26931..30879+ (R570 Sugarcane cultivar)
TTTATCGCCGGCTGCTAGGGTTTTATAGTTGGCGCCGCGACCTGAGCAGA ACCGCCTCCATCCCCGACGCCCCCTCATCGCGTGGCCGATCCTTAGCATC GCCGCCCTCCCCGTCCTCTCCTCCCGTTCCCTGCGGTATCCCTGACTCTC ACGCCGCCGCCTTCCAACGAGCCGACGTGCCGAACGGAGGGAGATCCGTC GTCCCCTGTCCTTCTCTCGGTAAGGAAGCCCCGATCAGACCTTCGTTTGT TCCAATCCATGTTCGAGGCGAGGCTTCGATTTTTTATTGCGGGGAAGGGG CTTAACTAGCCGTCCTATTAGTGATGATGCGTAATTTATGACACGCGCTC CACCACGGGGATTTGTGATACCTGATGAATTTGAATTGATTGAGGGAGCA TATGCAGCGGGTGGTTACCCATCCCACATGTGCCTTGTTGAGCTTGTTTC GTGGTTAATAGGATTATTAGGATGCCATGCGCTCCTAATTCGTTATAGAT TGTGTGCAGAGTACTATCTCCATGCCATGCTGCATTTGTTTACCTGCTTG TAAGTTAAAATCATTAGCACTGGTTTGACTGCACTTTGTTGAAGAATTAT GAGTTACATGACCTTGCAAATTGAACAAAGGGACTGTGTTGGTTCAAATC TCCTTTTTTGGTTACATATTCCCAGGGCTTAAGCTGGTCTGTCCACAGAT TTTTAAACAATTAAGAGTCCGGTAGCCTTATAAGAATTGAAAGCAAGACA AGGTACTGCATTTGTTCACATGTCCTATGTTACACATTCCAAATTGAAGA AAGTGACTGTTTGTTCAAATCCCCTTCCTTTGTTACATATTCTCAGTGTT TCTGTTGTTCTATCTGCTCATTGTTGAACAATTAAGGGTTCTGTAGCCTT AAGTTTTGAAAGAAAGGTGCTGCATTCGTTCATGTTCTATGTTATGTATG TATTACAATGAGGCACAACAGGGTTTGTGCACTCATTGTTGAACATTTAC AAGTTCTGTAGCCTTGCAAACTAGAAAGGGGGCTGCATTTGATAAAGTGT CCTAGGTTTCATATTCTGATGGCAGCAAGTGGGCTTAATGGCCATGATGG TGTACCTTAATTATTAATTCTTAATATACAGAATACTAGTAGCATTTATG CTGCTTTAGCTACCAAGTTTGCCTTTGCATGTATTTGGTCCTCGCATGCA ACTTGTATTACCACTTTATGAACTTAGATAGCAGATGGCATGCTAGAGAC TAAACTTCACATATTTTCAACTGGGTGATGGAACTTAGCTTCTTATTGTA TGTTTGTTCATTGTTTGGTCGCACTGATTACTATGTATAATTGTTGTATA TATTGTACTTCGAAAGATGCTGTTTATCAATTTGGAACTAATTTGCTAAG TATCTGGCTAATCGACTTGTTAATTTCTGCAGGCCGTATCATTTTATCTT GACTCAGGAACTTTGTTAACAATTTGAAATCATTGACATATGGAGTCCCA GAAGAGTTGTCTTTTGATCACTTACTCCCAGGAGATTGTAAATGGAGTTC CTTTGTATGTTTCATCAAACTGCCTGCCTGTAAAAGCTTTGAAATATGAA CCTGCTGGTCATTCGTTCCATGCTGCGGCAATGAAGCTTCTTGGTCTTGG GCAGCATGAAGACATTGAAACTGATGATCATAGTGTCTCATCGGATGACA AAAGCCAAGATTTTAATACTGCTTCTGACACCTTTAGCAGCAAAGGGAAG AAGAAGTCATCTGGCAGTCAACAGCAGGATCACTATGCATTGCTTGGGTT GGGACACTTGAGGTTCTTGGCCACTGAAGATCAGATTCGGAAAAGTTACC GTGACATGGCTCTCAAACATCATCCAGATAAGCAGGCTTCCTTGATTCTT GCAGAGACAACAGAGGAGGCAAAACAAGCAAAAAAGGATGAGATAGAGAG CCATTTCAAGGCCATCCAGGAGGCCTATGAAGTCCTCATTGACCCTACAA AGAGGAGGATTTATGACTCTACAGATGAGTTTGATGATGATGTCCCAACA GACTGTGCCCCACAAGACTTCTTCAAGGTTTTCGGCCCAGCCTTCATGAG AAATGGACGCTGGTCTGTTACCCAGCCTATTCCTTCTCTAGGAGATGATA CTACTACTGTAGAGGAGGTTGATAAGTTCTACAATTTCTGGTACAACTTC AAGAGTTGGAGGGAATTTCCAGATGATGATGAGTATGACTTGGAGCAAGC TGAATCTCGTGAACATAAGAGATGGATGGAGCGGCAGAACGCAAAGCTAC AAGAGAAGGCCAAAAAGGCGGAATATGCGCGAGTACGCACTCTTGTGGAC AATGCTTATAAGAAAGACCCAAGGATCCAGAGGAGGAAAGAGGAGGAGAA AGCTGAGAAACAGAGAAGAAAGGAGGCGAAGTATTTGGCAAAGAAATTGC AAGAAGAGGAAGCAGCAAGAGCTGCTGAAGAGGAAAGGATAATGAAAGAA GAAGAGTCTAAGAAAGCTGCAGAAGCTGCTCAGCATCAGAAGAAGCTAAA GGAGAAAGAGAAGAAGCTGCTCCGCAAAGAGAAAACTCGTCTGCGCACTC TTGCAGCACCTGTGGTTGCAGATAGCCACTTTGGTATGTCAGAGGAAGAT GTTGAATCAACATGTGCTAAACTTGATATGGAACAGCTGAAGAAGCTCTG TGATGGAATGGATGGCAAGGATGCAGCTGAAAAGGCCAGGTTGATGAGCA ATGCACTTCGCAATGGAAGTTCCTCAAAGGAAGCGAAGAAAATTGAAGCC AATGGTGTGGAGTGTTCTGCTCCAAAATCCAACTCTACAGGAGGTAGAGC GACAGAAGGCAGTAGCAGCATATTGAAGAGCTATGAAAAAAAAGAGAGAC CATGGAGAAAGGAAGAGGTTGAGATGCTTAGGAAAGCAATGCAAAAGTAT CCCAAGGGAACTTCGAGAAGATGGGAGGTTGTTTCAGAATTTATTGGGAC TAACAGATCGGTTGAGGAAATTCTCAAGGCCACTAAGAGTGTTCTTCTGC AGAAGCCAGACTCATCGAAAGCTTTCGACTCTTTCCTTGAGAAGCGCAAA CCGGCCCAATCTATTGCTTCACCTCTCTCGACCCGAGATGAAATTAGTTC CTCAACTGAGGGAGCTGGGACTGCATCGTCAAAGGCCGCGTCACAACCTG CGAGTAGCCAGGCAGCCAATGGGAAAGCTGCTGCTGATCCTTTCCCAGAT GGAGCACCATCTGTGGCAGATCCAGATGCCTGGACAGAGGCTCAGGTCCT GGCTCTAGTCCAAGCTTTGAAGGCTTTTCCCAAGGATGCAATCCAAAGAT GGGAGCGTGTAGCTGCTGCTGTCCCAGGTAAAACTTTTGTCCAGTGCAAG AAAAAGGTTGCAGCAATGAGAGAGAATTTCCGGAGCAAGAAAACTGGGGA GTAGACTGAGGCATTGCCTCACTAGAAGTACATTTTGCAGGGAAGAGAAA TCTCTGATGGCAATATTTTTATCCCTCAAAAAAAAAAGGATGGCAATATC TATAGATTGGATCTTGGCTGGTGAGGTATTACTTGGCGAATCTCTCATGC CTCCAGTGGTGAGGATAATTTTTGTTACGGAGCTATGATAACTCATTTAT TGTGCCAGGCCACCAGGGTGGTTTTACTTTGGTCAGCTGTAGGAGGATGC CATTGAAGCTCATCTACTGTTGATGGACTGATGATTGGCATTTTGTAGCA GTGGTTTGTGTTGACTTTGTTTCGTCTGGCTCCTGGGGTTGTCTATGCGT TGCTGGAATTGGTGCCCTGGTTCGGTAAAATGTAGAGAACCATATATGTT TTTATTCATTATTAATAACTATAAGATAGGAATATATGTTACATCGTGAG ACCTGTTATTGAAGTAAGCATTATTTTTCCTGGCCACGCACTTTGTAGT
back to top