Sh_009J10_g000080

Overview
NameSh_009J10_g000080
Unique NameSh_009J10_g000080
Typegene
OrganismR570 Sugarcane cultivar (R570 (sugarcane cultivar))
Sequence length5638
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sh_009J10contigSh_009J10:110320..115957
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Structural and functional annotation of S. officinarum2017-07-25
Properties
Property NameValue
Notesimilar to Expressed protein
TypemRNA
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Sh_009J10_t000080Sh_009J10_t000080R570 Sugarcane cultivarmRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Sh_009J10_g000080 ID=Sh_009J10_g000080|Name=Sh_009J10_g000080|organism=R570 Sugarcane cultivar|type=gene|length=5638bp
GTTAAAAAAAAAGGGAAAAAAAGGGGGTTTGCTTGAATTTGAAGCGCAGC
CATATCTGCTCGGAGCGCCGCCGCGCGAGATGGCCCCCTCCGCCAGCGAA
GCCACCTCGTCGTCGGCGACCAGTGCCACCTCGTCCTCGGACGCCGACGC
CCCGGCCTCCCCCTCGCCGTCCCCGTCCCGGCGCGCGGTGCCCACTCTGC
TCCTCGTCTCCTTCTTCGCCGCGCTCCTCGTCCTCTCCTCCGGCGACGAT
GCCACGGCGCAGCCGCTCAACGGTATCGTAAACCTTCGTCTTGTTCTGCG
ACTGCGTTCGTGTGTGCGCGCGCGCGCGGCGATTGTGTCTGTCTAGGGTT
TAGGGCTTTGCGTTGGCTCAGGATTTATGTTGTGAGATGCTGCGATTGTA
TACCCTAACTGGTTGGATTTTAGATAATGCTGGCGGCTTACTTTTCAGTG
ATGGCAAGTTGCATCTTCTTTCCTGAAGGAATATTCAATCATAAGCCGCT
TTGCTGGGAATCAAAGAATGTTGGATTGGTTCTGTTAGTAACTGTTGCTG
TAGTTTAATAACCTGCCCTTGGGAATCAAGCTTGGATCTTGTTGGGATTG
TTTTTTATATTATAATTATTAAGAACATATTAACATGTCCTAACAGCTAC
ACACAATAGCCCTTTTTATTTTGTTTCTTCTGTTATTGTAAGCACAGTGT
GAGATGTTATACCTGTAGTCCTTTTATGTGCTTGTTGCAGCTTGACGATT
GTCTATGCCTGGTGAATGTTGATTTCACGAAATTCCTGTTGATAATTTAA
TATTAAAGTGTATATTTATTCTTGTATTGTGTTTGGTAGTCATCCGTATG
ACGCTGTTTATTAAATTGGTCATTACTACTACAGGTGTTAGCTTGGAAAA
TCCAGAGGTTTCATTTGTTCCTTCCCCCTTGGATGGACAATTTTGTGAGC
GAGTCCTCCTATCTGGAGTGCCAAGGTTACATCTTGATAGCTATGCAAGC
CAAATTCGTGTCAAAATGAATGTCTCTCAGTCGATTCCTGAGAAGTTCCA
TTGGAAAATAGAGGTTTGCTTCCATAGGTAAGTCATGTTTTGACTCTTCC
CGACTGTAAATGTAGGCATTCTTAGTGTTCGGAAAACTGAAGCAGTTTAC
CTTTTGCAGGAATGCCTCCATGGATTTATGCCAGTGCGAGGCTGGTGAAT
GGCAAGGTTTTCAAGATGGGATGTGGACTGCTTTAAATTCTCCATATGGA
AACAAATATGTTGATGTGAAATTGGCTGATAAGAAACCTGCTAGGTTCAC
TCTTTCCATTCAGGAAGGTCAGGATTGTTCATGAAATCAATTCCTTTTTC
TTTTCAGTAATAAACTAGGAGCATCGATTTTTATTCTATATAAATCATTT
TTTGTTGTTTCAAATACTTATGCAGAGTTTCAGAAATGGCGTTTGGCTTG
CCTTGGTATTGGATTTGTATTGCTATTCCTCTCACCAATTGTTAGCAAAT
GGGCTCCCTTTTACTATAGCAGCTCTATGGCTCTTGGGATCCTGTTTGTT
GTTCTTATTGTACTTTTTCAGGTATATTTTTCCTCAAAAACATTTATATC
TTTCTGTAGTAAGGATTTGTTTCCATTGAAACTTGCAACTAGATCATTTC
ATAAAAAAATGTTATGTAGTACTTTATTGCCAGAGAGATATTGTCATAAC
AGTGTGTTAGACTGTTAGCCGCTTGACGGACCTTACTCAAGAAGCGTTTG
AAGTTTTTTTTTTTTAACTTGAGGTCTTGGAAAGAACATGGCTTGTTGTC
TTAATAGACTTAGTACCTGCTTGACATGACTGGATGGAAAGATAAAATAA
ACATGTTGTGTGTTATTGTTTATCTCTTTTTTTTGTAGGAGTATTGTTTC
TTTTATGATCCTGATATTGACCTGAGCCCTTTCATGCTATCCAGTTTTTT
TCCCCTTGAACAAATACTGTCCAGTTATTTAGAAGTCCACTTTGTACCGT
TGCCCATAATCATCTGAATACATGTGAATCAGATTCATGCTTTCGAATAT
CATCATTTGGAATATCAGCAGTGACCAGACAGTTTCACTGTTTTTTGTTA
CTAATTGGTACTGAACTTGATATAATGTCTACACCTTTTTCTCAAGAAAT
TTTCTGACTACTAGTTTATAGTGATCTTGTAGTGTTAGTATTTTGATTCA
TTTATAATTTTCTCCTTAGATAGATTTGGAACATGTAGTGTTCAGGTTGG
CTAAACCAATAGTGCCGTGTTATTTTCAAATTTTCTGACAAAAAGAACTG
CAAATTTCTACTTCCTTTATATTTGTTGATGATGGTCCATGTTTCCTACG
ATAACAATATTGATGTCTGACATTGCCTTCATTTTAGGGGATGAAATTGC
TACCAATGGGCAGGAAAAGTTTATTTTACCTTGCAATTTATGGATCTGTG
GTAATTACCTTGTACCCACACCATTTTGCAGCTATTTGAATAGGCACTTC
TCACTAATTATTTGTACTCATTCATTTTCATTTTCTTTTTACGGACATTT
AGTTAGGTGTTGGTTCCTATGTTGTACACTACTTCTCAACATTGGTCTCT
TCTATTCTCGAAAACTTCGGCTTGAGTGAAGAGTTGTACAACCCTGTAAG
TAATTCCTCTTGCATGTTTTCTAATAATAAATCAACTAACTATTTTTACT
CATTTCCCATTTTTGCTTGCACAATATTATTTACTGTTTTCTTTTGTATT
CTGGATTTCGGTTTTCTAATGTTTGTTACATCAGAAATGGAGCACACCAG
TTTATTTAGTAGTGCTAGTATCACCATTATGTGGCTTTGGAAAGAATTAT
AGAAACTAGAGCATGTGTATCAAGTTGGAAGGGGGTTTTTGTTGGTTCTG
AATTTTATTTTTGGGCCTGATCTCAGTAACTAGGAAGGGCAGACCTAGTG
CAGTTGGTGAGTGCTAGCTCGCCGAGTCACCAGGTCCTGGGTTCGAAGCC
GTCTCTCTGCAGAATTTCTGCGGGGGTAAGACTTTGCTTCGGTTATTCCC
TTCCCCAGACCCCACTCGTGTGGGAGCCTCTGGCACTGGGTCTGCCTGAT
CTCAGTAACTGATAGCCTGAACCCTGAATTTATTACTTATAGACAGAATC
AATACACCCAATTGTTCATTATAAACATAGCCTTTGGGAGCTAAATTAAT
CTATATCCTGCTAATGTTTTACGTTTACCAAGATGCACATTACACCTGCC
TCAGTTTTTGTTGTTATGATTGGAACGTAGTCTGCAATGATAACTTGTTT
ATTTCTGATTTCTGACTTACCAAGATGAACATGATACCTGCCTCTGTTTT
TGTCATTATGATTGGAATGTAGTCTGCAAAGATAACTTATGTATTTTTTA
CTCCTGACTTTAACCAATTATTATCTGGATACTTTGATGTTGTTGTGATT
TGTAAGAAATGATGTCAGATAAGTGTAAATGATATGGAAGTTAATAGTGT
ATTAAATGCATTGCTACATGGCGGTATGGTTACTTCAAACATCAGAAGTT
TTTTTTCTTTTAATGAAGTTTGAAACTTTGACTTATGTAGCTTACAAGAG
AATAATCCCAGATCTACTGCCCCGTTGATCTATTTGGTGCACTGTGGTAA
AATAAATAATGGTTGAGTTTTTTATTTTTGTTTGGTATTTGCCTTCTATA
TAAAACCTAACTGATGAGCAAAAACATAGTGTGCTGCATATAGAGTTCCA
TGCTTTTATATGAGACCATGCCTGCTGGGCCATAACTCATAATTGGCACA
TAATCACCTTAAAGACTGCACACTTATGGTTCACCATACGCATTTTTTTT
TATCTTTTGCTATTGCTTGGAACACTGGACGTTTCTCTGCAATTCTCTGA
TATGGTATAATGGAACACTTATGGTTCACCATACACAGTTTGTTACACTT
GTTGATCTGTGTGGTATAATGGACTATTCATTACTTGTTTAAGTACATCA
GTCTGTTACATAGTTACCTTTACCTGTTATACAAGTCTTTAAGTAACAAA
AATTAATGATGAATTACAGGTTTCTATCTTCCTGCTGGTGGCAATTGTCT
TCACTGGAGCTGGTTTTGGCTATTGGATGGTCAGGAGATTTATCCTTTCA
AAAGATGGAAGTGTAGATGCTGGGATAGCGCAATTTGTAAAGTGGGCTAT
GCGTGTTGTTGCTACATTATTCATTATGCAGGTGTGGTTCTATCTTGTTT
TCCCTTACCATGTTAAGTATTCTTCTCAAGAACCTGTCTAGTTTGTATCT
TGTCCCATGCTTTGGATAAGGTTGCAGTTAACTGCTTTGAATTTCGTATC
TGACATGCTGTTTATCTTTCCAGAGCACACTTGATCCTCTTCTAGCACTG
GTTTCTCTTGCTTTTAGCTGGTGGTTATGCTCTTTGTTGACTGCAAAGAA
AGTTCAGAAGACAATGACCCAGTTAGTACCTCAAGTTAGTTGTCATTGAT
GTTGTCTTTGTACCTGTTGAAGTACTGAGTATGCTAGTTCTTCTGCAGGA
AACAAAAGCAGTCAATGGTTCTTTCTCACCAAATGCTTACTCAAGGATTG
CCCAAGAGTCCTAAAATCCAGTTCTTAAGTCCATCTAAGATAGGCTTTGG
AAGAACCACATCTAGAAGTTCCGCCACACAGTACGGTCGGAGCAATTTGG
CAAATGGAGGTAATATAACTAGTATTGTTTGCAACTTGAAAGTTTTCTGT
TGGCTTGTAGTCAGCATTCTTTATACGATACTGTTAAACAACGTTCACAT
GTTAGAAGTTGTGTTTTCATTCATTTGAGCTAATGACAGGACATTTCCAT
ACAATTTTTTGATTGAACTATTTTATTTGAACACATTGTAGTGTTTGACT
TGACTAGACACTGGGTTTCGCAGGTCTGGTCTGCTCAGCACTTACAAAGC
ACGTAGTACCCAACGAAGATGACGAAGATCACTACTCTACCTTCCACAAC
ATCCAGCCACGGAAATATTCCAAGGAGGAATGGGAGGACTTCACCCAGAA
ATCGACTAGGAAGGCACTTGCGGAGTGCACAGCAACCCCGGAGTTTGCCC
AATGGGTCGCTGACAATGCTCATCGTTTGCAAGTAGAGAAAGAGGAAGAC
AACTTCTCAGAGGAAGAGACCATCGAGAGCTCCAACTCCTCGGAAGAAAC
TGGGGACGAAGCTGATGGAGCTCCAGGTCTGATCAGGCTGTGGGGCTAGC
ATGCTGGTTGAACTAAGCATGCTCCTGCCATTTCACGTGTAAAGAGTAGC
AAGCGCCCATTTTAACTAGTTTAGCAGCAGGGTAGGGTGGTAGCAGTTGA
TTGTTTCCAGTTATTGCCACGGTAGGTTCGTTCTGTCCGGTGGCAGTAGT
TGGCTAGCCATCTCAGGTCAATTGATGCTAGGTTTAGCTAGCTTGGTTAT
CAGTGGATTCTTAGTTCTTTAGAGCTGATAGGTGAAATGGTTTAAACAGT
CTAATTTATGATTGGAATCCAGCATTGTGCTGATTCAGTTGGAAATTTGA
AGTTGGGTCATTAGGCATTTCTTGGTGCTCCATTTGGATGGATGGACTCA
TGGACAGCATGTGTGTAGAGTGGGTCCCTCGCTTCGCT
back to top

gene from alignment at Sh_009J10:110320..115957+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Sh_009J10_g000080 ID=Sh_009J10_g000080|Name=Sh_009J10_g000080|organism=R570 Sugarcane cultivar|type=gene|length=5638bp|location=Sequence derived from alignment at Sh_009J10:110320..115957+ (R570 Sugarcane cultivar)
GTTAAAAAAAAAGGGAAAAAAAGGGGGTTTGCTTGAATTTGAAGCGCAGC CATATCTGCTCGGAGCGCCGCCGCGCGAGATGGCCCCCTCCGCCAGCGAA GCCACCTCGTCGTCGGCGACCAGTGCCACCTCGTCCTCGGACGCCGACGC CCCGGCCTCCCCCTCGCCGTCCCCGTCCCGGCGCGCGGTGCCCACTCTGC TCCTCGTCTCCTTCTTCGCCGCGCTCCTCGTCCTCTCCTCCGGCGACGAT GCCACGGCGCAGCCGCTCAACGGTATCGTAAACCTTCGTCTTGTTCTGCG ACTGCGTTCGTGTGTGCGCGCGCGCGCGGCGATTGTGTCTGTCTAGGGTT TAGGGCTTTGCGTTGGCTCAGGATTTATGTTGTGAGATGCTGCGATTGTA TACCCTAACTGGTTGGATTTTAGATAATGCTGGCGGCTTACTTTTCAGTG ATGGCAAGTTGCATCTTCTTTCCTGAAGGAATATTCAATCATAAGCCGCT TTGCTGGGAATCAAAGAATGTTGGATTGGTTCTGTTAGTAACTGTTGCTG TAGTTTAATAACCTGCCCTTGGGAATCAAGCTTGGATCTTGTTGGGATTG TTTTTTATATTATAATTATTAAGAACATATTAACATGTCCTAACAGCTAC ACACAATAGCCCTTTTTATTTTGTTTCTTCTGTTATTGTAAGCACAGTGT GAGATGTTATACCTGTAGTCCTTTTATGTGCTTGTTGCAGCTTGACGATT GTCTATGCCTGGTGAATGTTGATTTCACGAAATTCCTGTTGATAATTTAA TATTAAAGTGTATATTTATTCTTGTATTGTGTTTGGTAGTCATCCGTATG ACGCTGTTTATTAAATTGGTCATTACTACTACAGGTGTTAGCTTGGAAAA TCCAGAGGTTTCATTTGTTCCTTCCCCCTTGGATGGACAATTTTGTGAGC GAGTCCTCCTATCTGGAGTGCCAAGGTTACATCTTGATAGCTATGCAAGC CAAATTCGTGTCAAAATGAATGTCTCTCAGTCGATTCCTGAGAAGTTCCA TTGGAAAATAGAGGTTTGCTTCCATAGGTAAGTCATGTTTTGACTCTTCC CGACTGTAAATGTAGGCATTCTTAGTGTTCGGAAAACTGAAGCAGTTTAC CTTTTGCAGGAATGCCTCCATGGATTTATGCCAGTGCGAGGCTGGTGAAT GGCAAGGTTTTCAAGATGGGATGTGGACTGCTTTAAATTCTCCATATGGA AACAAATATGTTGATGTGAAATTGGCTGATAAGAAACCTGCTAGGTTCAC TCTTTCCATTCAGGAAGGTCAGGATTGTTCATGAAATCAATTCCTTTTTC TTTTCAGTAATAAACTAGGAGCATCGATTTTTATTCTATATAAATCATTT TTTGTTGTTTCAAATACTTATGCAGAGTTTCAGAAATGGCGTTTGGCTTG CCTTGGTATTGGATTTGTATTGCTATTCCTCTCACCAATTGTTAGCAAAT GGGCTCCCTTTTACTATAGCAGCTCTATGGCTCTTGGGATCCTGTTTGTT GTTCTTATTGTACTTTTTCAGGTATATTTTTCCTCAAAAACATTTATATC TTTCTGTAGTAAGGATTTGTTTCCATTGAAACTTGCAACTAGATCATTTC ATAAAAAAATGTTATGTAGTACTTTATTGCCAGAGAGATATTGTCATAAC AGTGTGTTAGACTGTTAGCCGCTTGACGGACCTTACTCAAGAAGCGTTTG AAGTTTTTTTTTTTTAACTTGAGGTCTTGGAAAGAACATGGCTTGTTGTC TTAATAGACTTAGTACCTGCTTGACATGACTGGATGGAAAGATAAAATAA ACATGTTGTGTGTTATTGTTTATCTCTTTTTTTTGTAGGAGTATTGTTTC TTTTATGATCCTGATATTGACCTGAGCCCTTTCATGCTATCCAGTTTTTT TCCCCTTGAACAAATACTGTCCAGTTATTTAGAAGTCCACTTTGTACCGT TGCCCATAATCATCTGAATACATGTGAATCAGATTCATGCTTTCGAATAT CATCATTTGGAATATCAGCAGTGACCAGACAGTTTCACTGTTTTTTGTTA CTAATTGGTACTGAACTTGATATAATGTCTACACCTTTTTCTCAAGAAAT TTTCTGACTACTAGTTTATAGTGATCTTGTAGTGTTAGTATTTTGATTCA TTTATAATTTTCTCCTTAGATAGATTTGGAACATGTAGTGTTCAGGTTGG CTAAACCAATAGTGCCGTGTTATTTTCAAATTTTCTGACAAAAAGAACTG CAAATTTCTACTTCCTTTATATTTGTTGATGATGGTCCATGTTTCCTACG ATAACAATATTGATGTCTGACATTGCCTTCATTTTAGGGGATGAAATTGC TACCAATGGGCAGGAAAAGTTTATTTTACCTTGCAATTTATGGATCTGTG GTAATTACCTTGTACCCACACCATTTTGCAGCTATTTGAATAGGCACTTC TCACTAATTATTTGTACTCATTCATTTTCATTTTCTTTTTACGGACATTT AGTTAGGTGTTGGTTCCTATGTTGTACACTACTTCTCAACATTGGTCTCT TCTATTCTCGAAAACTTCGGCTTGAGTGAAGAGTTGTACAACCCTGTAAG TAATTCCTCTTGCATGTTTTCTAATAATAAATCAACTAACTATTTTTACT CATTTCCCATTTTTGCTTGCACAATATTATTTACTGTTTTCTTTTGTATT CTGGATTTCGGTTTTCTAATGTTTGTTACATCAGAAATGGAGCACACCAG TTTATTTAGTAGTGCTAGTATCACCATTATGTGGCTTTGGAAAGAATTAT AGAAACTAGAGCATGTGTATCAAGTTGGAAGGGGGTTTTTGTTGGTTCTG AATTTTATTTTTGGGCCTGATCTCAGTAACTAGGAAGGGCAGACCTAGTG CAGTTGGTGAGTGCTAGCTCGCCGAGTCACCAGGTCCTGGGTTCGAAGCC GTCTCTCTGCAGAATTTCTGCGGGGGTAAGACTTTGCTTCGGTTATTCCC TTCCCCAGACCCCACTCGTGTGGGAGCCTCTGGCACTGGGTCTGCCTGAT CTCAGTAACTGATAGCCTGAACCCTGAATTTATTACTTATAGACAGAATC AATACACCCAATTGTTCATTATAAACATAGCCTTTGGGAGCTAAATTAAT CTATATCCTGCTAATGTTTTACGTTTACCAAGATGCACATTACACCTGCC TCAGTTTTTGTTGTTATGATTGGAACGTAGTCTGCAATGATAACTTGTTT ATTTCTGATTTCTGACTTACCAAGATGAACATGATACCTGCCTCTGTTTT TGTCATTATGATTGGAATGTAGTCTGCAAAGATAACTTATGTATTTTTTA CTCCTGACTTTAACCAATTATTATCTGGATACTTTGATGTTGTTGTGATT TGTAAGAAATGATGTCAGATAAGTGTAAATGATATGGAAGTTAATAGTGT ATTAAATGCATTGCTACATGGCGGTATGGTTACTTCAAACATCAGAAGTT TTTTTTCTTTTAATGAAGTTTGAAACTTTGACTTATGTAGCTTACAAGAG AATAATCCCAGATCTACTGCCCCGTTGATCTATTTGGTGCACTGTGGTAA AATAAATAATGGTTGAGTTTTTTATTTTTGTTTGGTATTTGCCTTCTATA TAAAACCTAACTGATGAGCAAAAACATAGTGTGCTGCATATAGAGTTCCA TGCTTTTATATGAGACCATGCCTGCTGGGCCATAACTCATAATTGGCACA TAATCACCTTAAAGACTGCACACTTATGGTTCACCATACGCATTTTTTTT TATCTTTTGCTATTGCTTGGAACACTGGACGTTTCTCTGCAATTCTCTGA TATGGTATAATGGAACACTTATGGTTCACCATACACAGTTTGTTACACTT GTTGATCTGTGTGGTATAATGGACTATTCATTACTTGTTTAAGTACATCA GTCTGTTACATAGTTACCTTTACCTGTTATACAAGTCTTTAAGTAACAAA AATTAATGATGAATTACAGGTTTCTATCTTCCTGCTGGTGGCAATTGTCT TCACTGGAGCTGGTTTTGGCTATTGGATGGTCAGGAGATTTATCCTTTCA AAAGATGGAAGTGTAGATGCTGGGATAGCGCAATTTGTAAAGTGGGCTAT GCGTGTTGTTGCTACATTATTCATTATGCAGGTGTGGTTCTATCTTGTTT TCCCTTACCATGTTAAGTATTCTTCTCAAGAACCTGTCTAGTTTGTATCT TGTCCCATGCTTTGGATAAGGTTGCAGTTAACTGCTTTGAATTTCGTATC TGACATGCTGTTTATCTTTCCAGAGCACACTTGATCCTCTTCTAGCACTG GTTTCTCTTGCTTTTAGCTGGTGGTTATGCTCTTTGTTGACTGCAAAGAA AGTTCAGAAGACAATGACCCAGTTAGTACCTCAAGTTAGTTGTCATTGAT GTTGTCTTTGTACCTGTTGAAGTACTGAGTATGCTAGTTCTTCTGCAGGA AACAAAAGCAGTCAATGGTTCTTTCTCACCAAATGCTTACTCAAGGATTG CCCAAGAGTCCTAAAATCCAGTTCTTAAGTCCATCTAAGATAGGCTTTGG AAGAACCACATCTAGAAGTTCCGCCACACAGTACGGTCGGAGCAATTTGG CAAATGGAGGTAATATAACTAGTATTGTTTGCAACTTGAAAGTTTTCTGT TGGCTTGTAGTCAGCATTCTTTATACGATACTGTTAAACAACGTTCACAT GTTAGAAGTTGTGTTTTCATTCATTTGAGCTAATGACAGGACATTTCCAT ACAATTTTTTGATTGAACTATTTTATTTGAACACATTGTAGTGTTTGACT TGACTAGACACTGGGTTTCGCAGGTCTGGTCTGCTCAGCACTTACAAAGC ACGTAGTACCCAACGAAGATGACGAAGATCACTACTCTACCTTCCACAAC ATCCAGCCACGGAAATATTCCAAGGAGGAATGGGAGGACTTCACCCAGAA ATCGACTAGGAAGGCACTTGCGGAGTGCACAGCAACCCCGGAGTTTGCCC AATGGGTCGCTGACAATGCTCATCGTTTGCAAGTAGAGAAAGAGGAAGAC AACTTCTCAGAGGAAGAGACCATCGAGAGCTCCAACTCCTCGGAAGAAAC TGGGGACGAAGCTGATGGAGCTCCAGGTCTGATCAGGCTGTGGGGCTAGC ATGCTGGTTGAACTAAGCATGCTCCTGCCATTTCACGTGTAAAGAGTAGC AAGCGCCCATTTTAACTAGTTTAGCAGCAGGGTAGGGTGGTAGCAGTTGA TTGTTTCCAGTTATTGCCACGGTAGGTTCGTTCTGTCCGGTGGCAGTAGT TGGCTAGCCATCTCAGGTCAATTGATGCTAGGTTTAGCTAGCTTGGTTAT CAGTGGATTCTTAGTTCTTTAGAGCTGATAGGTGAAATGGTTTAAACAGT CTAATTTATGATTGGAATCCAGCATTGTGCTGATTCAGTTGGAAATTTGA AGTTGGGTCATTAGGCATTTCTTGGTGCTCCATTTGGATGGATGGACTCA TGGACAGCATGTGTGTAGAGTGGGTCCCTCGCTTCGCT
back to top